Incidental Mutation 'R0037:Il5ra'
ID 64626
Institutional Source Beutler Lab
Gene Symbol Il5ra
Ensembl Gene ENSMUSG00000005364
Gene Name interleukin 5 receptor, alpha
Synonyms CDw125, Il5r, IL-5 receptor alpha chain, CD125
MMRRC Submission 038331-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.088) question?
Stock # R0037 (G1)
Quality Score 116
Status Not validated
Chromosome 6
Chromosomal Location 106687336-106725998 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 106719647 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 62 (Y62F)
Ref Sequence ENSEMBL: ENSMUSP00000144718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167925] [ENSMUST00000204659] [ENSMUST00000205004]
AlphaFold P21183
Predicted Effect probably damaging
Transcript: ENSMUST00000167925
AA Change: Y62F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129781
Gene: ENSMUSG00000005364
AA Change: Y62F

DomainStartEndE-ValueType
FN3 27 159 6.27e0 SMART
FN3 236 312 1.28e1 SMART
transmembrane domain 335 357 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000204659
AA Change: Y62F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144718
Gene: ENSMUSG00000005364
AA Change: Y62F

DomainStartEndE-ValueType
FN3 27 159 6.27e0 SMART
FN3 236 312 1.28e1 SMART
transmembrane domain 335 357 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205004
Meta Mutation Damage Score 0.8994 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an interleukin 5 specific subunit of a heterodimeric cytokine receptor. The receptor is comprised of a ligand specific alpha subunit and a signal transducing beta subunit shared by the receptors for interleukin 3 (IL3), colony stimulating factor 2 (CSF2/GM-CSF), and interleukin 5 (IL5). The binding of this protein to IL5 depends on the beta subunit. The beta subunit is activated by the ligand binding, and is required for the biological activities of IL5. This protein has been found to interact with syndecan binding protein (syntenin), which is required for IL5 mediated activation of the transcription factor SOX4. Several alternatively spliced transcript variants encoding four distinct isoforms have been reported. [provided by RefSeq, Jul 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene display a generally normal phenotype but with some immune system deficiencies. Mice homozygous for one knock-out allele exhibit increased metastasis of injected B16F10 melanoma cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 10 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Dusp26 G A 8: 31,586,388 (GRCm39) R203H unknown Het
Ect2l A G 10: 18,018,845 (GRCm39) L517P probably damaging Het
Lrp4 A G 2: 91,301,548 (GRCm39) T43A probably benign Het
Pfas A G 11: 68,890,862 (GRCm39) Y350H probably damaging Het
Ppp1r16b T A 2: 158,599,129 (GRCm39) I367N probably damaging Het
Ralgapb T C 2: 158,279,331 (GRCm39) L139S probably damaging Het
Swap70 T A 7: 109,863,287 (GRCm39) N205K possibly damaging Het
Trim24 A T 6: 37,934,484 (GRCm39) N733I probably damaging Het
Ttn A G 2: 76,693,616 (GRCm39) probably null Het
Uggt1 A T 1: 36,225,013 (GRCm39) D540E probably benign Het
Other mutations in Il5ra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00715:Il5ra APN 6 106,689,435 (GRCm39) splice site probably benign
IGL00726:Il5ra APN 6 106,715,450 (GRCm39) missense probably damaging 1.00
IGL01095:Il5ra APN 6 106,719,605 (GRCm39) intron probably benign
IGL01562:Il5ra APN 6 106,708,865 (GRCm39) missense probably benign 0.00
IGL01569:Il5ra APN 6 106,708,794 (GRCm39) start codon destroyed probably null
IGL02346:Il5ra APN 6 106,719,619 (GRCm39) missense probably benign 0.02
IGL02573:Il5ra APN 6 106,693,712 (GRCm39) missense possibly damaging 0.93
IGL02659:Il5ra APN 6 106,719,644 (GRCm39) missense possibly damaging 0.49
R0037:Il5ra UTSW 6 106,719,647 (GRCm39) missense probably damaging 1.00
R0294:Il5ra UTSW 6 106,689,362 (GRCm39) missense probably benign 0.41
R0463:Il5ra UTSW 6 106,708,851 (GRCm39) missense probably damaging 0.99
R0478:Il5ra UTSW 6 106,715,423 (GRCm39) missense probably benign
R0597:Il5ra UTSW 6 106,721,296 (GRCm39) start codon destroyed probably null 0.99
R1526:Il5ra UTSW 6 106,712,781 (GRCm39) missense possibly damaging 0.49
R1695:Il5ra UTSW 6 106,715,335 (GRCm39) nonsense probably null
R1888:Il5ra UTSW 6 106,708,874 (GRCm39) missense probably damaging 1.00
R1888:Il5ra UTSW 6 106,708,874 (GRCm39) missense probably damaging 1.00
R2176:Il5ra UTSW 6 106,715,233 (GRCm39) missense probably benign
R2207:Il5ra UTSW 6 106,689,402 (GRCm39) nonsense probably null
R2973:Il5ra UTSW 6 106,718,196 (GRCm39) missense probably benign 0.08
R4546:Il5ra UTSW 6 106,715,459 (GRCm39) nonsense probably null
R4842:Il5ra UTSW 6 106,715,336 (GRCm39) missense probably damaging 1.00
R4851:Il5ra UTSW 6 106,715,432 (GRCm39) missense probably benign 0.06
R4911:Il5ra UTSW 6 106,692,629 (GRCm39) missense probably damaging 1.00
R4936:Il5ra UTSW 6 106,715,123 (GRCm39) missense possibly damaging 0.90
R5297:Il5ra UTSW 6 106,715,095 (GRCm39) missense probably benign 0.09
R6035:Il5ra UTSW 6 106,718,226 (GRCm39) missense probably damaging 1.00
R6035:Il5ra UTSW 6 106,718,226 (GRCm39) missense probably damaging 1.00
R8103:Il5ra UTSW 6 106,692,611 (GRCm39) missense possibly damaging 0.87
R8338:Il5ra UTSW 6 106,689,350 (GRCm39) missense probably benign 0.09
R8497:Il5ra UTSW 6 106,715,066 (GRCm39) missense probably benign 0.01
R8936:Il5ra UTSW 6 106,692,604 (GRCm39) missense possibly damaging 0.94
R9397:Il5ra UTSW 6 106,721,258 (GRCm39) missense probably benign 0.10
R9576:Il5ra UTSW 6 106,712,688 (GRCm39) missense probably damaging 1.00
R9583:Il5ra UTSW 6 106,721,297 (GRCm39) start codon destroyed possibly damaging 0.84
R9583:Il5ra UTSW 6 106,689,331 (GRCm39) missense unknown
Z1177:Il5ra UTSW 6 106,718,095 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCCTACTGCTAACACAACAAGATGGTCT -3'
(R):5'- GTCATGCTTGATATAACCGCCATTCCT -3'

Sequencing Primer
(F):5'- ACAACAAGATGGTCTTTAGTAATTGG -3'
(R):5'- atattCAAGACCAGGAATATTGCTC -3'
Posted On 2013-08-06