Mutagenetix > Incidental Mutation

Incidental Mutation 'R0823:Rad18'

78154

Institutional Source

Beutler Lab

Gene Symbol

Rad18

Ensembl Gene

ENSMUSG00000030254

Gene Name

RAD18 E3 ubiquitin protein ligase

Synonyms

2810024C04Rik

MMRRC Submission

039003-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0823 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

112596811-112673647 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 112642260 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Lysine at position 336 (E336K)

Ref Sequence

ENSEMBL: ENSMUSP00000070619 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000068487] [ENSMUST00000077088] [ENSMUST00000113180] [ENSMUST00000113182] [ENSMUST00000142079] [ENSMUST00000156063]

AlphaFold

Q9QXK2

Predicted Effect

possibly damaging
Transcript: ENSMUST00000068487
AA Change: E336K

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000070619
Gene: ENSMUSG00000030254
AA Change: E336K

Domain	Start	End	E-Value	Type
RING	25	63	3.12e-6	SMART
low complexity region	99	116	N/A	INTRINSIC
ZnF_Rad18	201	224	3.61e-10	SMART
SAP	248	282	2.71e-11	SMART
internal_repeat_1	398	422	2.94e-14	PROSPERO
internal_repeat_1	422	446	2.94e-14	PROSPERO
low complexity region	473	488	N/A	INTRINSIC
low complexity region	495	507	N/A	INTRINSIC
low complexity region	514	522	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000077088
AA Change: E336K

PolyPhen 2 Score 0.676 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000076341
Gene: ENSMUSG00000030254
AA Change: E336K

Domain	Start	End	E-Value	Type
RING	25	63	3.12e-6	SMART
low complexity region	99	116	N/A	INTRINSIC
ZnF_Rad18	201	224	3.61e-10	SMART
SAP	248	282	2.71e-11	SMART
PDB:2YBF\|B	340	363	7e-6	PDB
internal_repeat_1	372	396	1.24e-14	PROSPERO
internal_repeat_1	396	420	1.24e-14	PROSPERO
low complexity region	447	462	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000113180
AA Change: E336K

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000108805
Gene: ENSMUSG00000030254
AA Change: E336K

Domain	Start	End	E-Value	Type
RING	25	63	3.12e-6	SMART
low complexity region	99	116	N/A	INTRINSIC
ZnF_Rad18	201	224	3.61e-10	SMART
SAP	248	282	2.71e-11	SMART
low complexity region	366	381	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000113182
AA Change: E336K

PolyPhen 2 Score 0.201 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000108807
Gene: ENSMUSG00000030254
AA Change: E336K

Domain	Start	End	E-Value	Type
RING	25	63	3.12e-6	SMART
low complexity region	99	116	N/A	INTRINSIC
ZnF_Rad18	201	224	3.61e-10	SMART
SAP	248	282	2.71e-11	SMART
low complexity region	366	381	N/A	INTRINSIC
low complexity region	388	400	N/A	INTRINSIC
low complexity region	407	415	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132590

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135092

Predicted Effect

possibly damaging
Transcript: ENSMUST00000142079
AA Change: E50K

PolyPhen 2 Score 0.778 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000117582
Gene: ENSMUSG00000030254
AA Change: E50K

Domain	Start	End	E-Value	Type
internal_repeat_1	112	136	3.29e-13	PROSPERO
internal_repeat_1	136	160	3.29e-13	PROSPERO
low complexity region	187	202	N/A	INTRINSIC

Predicted Effect

silent
Transcript: ENSMUST00000156063

SMART Domains

Protein: ENSMUSP00000138558
Gene: ENSMUSG00000030254

Domain	Start	End	E-Value	Type
RING	25	63	3.12e-6	SMART
low complexity region	99	116	N/A	INTRINSIC
ZnF_Rad18	201	224	3.61e-10	SMART
SAP	248	282	2.71e-11	SMART

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.3%
20x: 94.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is highly similar to S. cerevisiae DNA damage repair protein Rad18. Yeast Rad18 functions through its interaction with Rad6, which is an ubiquitin-conjugating enzyme required for post-replication repair of damaged DNA. Similar to its yeast counterpart, this protein is able to interact with the human homolog of yeast Rad6 protein through a conserved ring-finger motif. Mutation of this motif results in defective replication of UV-damaged DNA and hypersensitivity to multiple mutagens. [provided by RefSeq, Jul 2008]
PHENOTYPE: Male mice homozygous for a null allele exhibit age-dependent decrease in fertility, germ cell number, and testes weight with progressive degeneration of seminiferous tubules. [provided by MGI curators]

Allele List at MGI

All alleles(6) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(4)

Other mutations in this stock

Total: 1 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Mybpc2	T	C	7: 44,156,311 (GRCm39)	K834R	probably benign	Het

Other mutations in Rad18

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01577:Rad18	APN	6	112,642,302 (GRCm39)	splice site	probably benign
IGL02425:Rad18	APN	6	112,597,859 (GRCm39)	missense	probably damaging	1.00
IGL02622:Rad18	APN	6	112,664,948 (GRCm39)	missense	probably damaging	0.99
IGL02814:Rad18	APN	6	112,621,583 (GRCm39)	missense	possibly damaging	0.72
3-1:Rad18	UTSW	6	112,658,472 (GRCm39)	nonsense	probably null
R1220:Rad18	UTSW	6	112,626,625 (GRCm39)	nonsense	probably null
R1351:Rad18	UTSW	6	112,597,863 (GRCm39)	missense	possibly damaging	0.55
R1378:Rad18	UTSW	6	112,658,297 (GRCm39)	splice site	probably benign
R1623:Rad18	UTSW	6	112,605,480 (GRCm39)	missense	probably damaging	1.00
R1737:Rad18	UTSW	6	112,658,498 (GRCm39)	missense	probably damaging	1.00
R2509:Rad18	UTSW	6	112,652,883 (GRCm39)	missense	possibly damaging	0.93
R2893:Rad18	UTSW	6	112,652,734 (GRCm39)	nonsense	probably null
R2894:Rad18	UTSW	6	112,652,734 (GRCm39)	nonsense	probably null
R3017:Rad18	UTSW	6	112,658,327 (GRCm39)	missense	possibly damaging	0.95
R3123:Rad18	UTSW	6	112,658,307 (GRCm39)	missense	probably benign	0.41
R3755:Rad18	UTSW	6	112,670,432 (GRCm39)	missense	probably damaging	1.00
R4392:Rad18	UTSW	6	112,670,490 (GRCm39)	missense	probably damaging	1.00
R5285:Rad18	UTSW	6	112,663,726 (GRCm39)	missense	probably benign	0.45
R5566:Rad18	UTSW	6	112,658,307 (GRCm39)	missense	probably benign	0.41
R5958:Rad18	UTSW	6	112,673,603 (GRCm39)	unclassified	probably benign
R6744:Rad18	UTSW	6	112,652,745 (GRCm39)	missense	probably damaging	1.00
R7072:Rad18	UTSW	6	112,658,401 (GRCm39)	missense	probably benign	0.01
R7247:Rad18	UTSW	6	112,642,286 (GRCm39)	missense	possibly damaging	0.81
R7860:Rad18	UTSW	6	112,626,798 (GRCm39)	missense	probably benign	0.01
R8223:Rad18	UTSW	6	112,664,982 (GRCm39)	nonsense	probably null
R8959:Rad18	UTSW	6	112,605,444 (GRCm39)	missense	probably damaging	0.99
R9024:Rad18	UTSW	6	112,626,562 (GRCm39)	missense	probably benign	0.01
R9582:Rad18	UTSW	6	112,658,298 (GRCm39)	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- AACGCAGTCTCTGAAGCAGCAC -3'
(R):5'- TGGGATTTCCTTCCTGGATGCCAC -3'

Sequencing Primer
(F):5'- GAAGCAGCACTAACAAGATTATCTG -3'
(R):5'- TTGAGTCAAAGGTTGCCCC -3'

Posted On

2013-10-16