Incidental Mutation 'R1737:Rad18'
ID199772
Institutional Source Beutler Lab
Gene Symbol Rad18
Ensembl Gene ENSMUSG00000030254
Gene NameRAD18 E3 ubiquitin protein ligase
Synonyms2810024C04Rik
MMRRC Submission 039769-MU
Accession Numbers

Genbank: NM_001167730, NM_021385; MGI: 1890476

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1737 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location112619850-112696686 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 112681537 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 136 (F136L)
Ref Sequence ENSEMBL: ENSMUSP00000108805 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068487] [ENSMUST00000077088] [ENSMUST00000113180] [ENSMUST00000113182] [ENSMUST00000156063]
Predicted Effect probably damaging
Transcript: ENSMUST00000068487
AA Change: F136L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000070619
Gene: ENSMUSG00000030254
AA Change: F136L

DomainStartEndE-ValueType
RING 25 63 3.12e-6 SMART
low complexity region 99 116 N/A INTRINSIC
ZnF_Rad18 201 224 3.61e-10 SMART
SAP 248 282 2.71e-11 SMART
internal_repeat_1 398 422 2.94e-14 PROSPERO
internal_repeat_1 422 446 2.94e-14 PROSPERO
low complexity region 473 488 N/A INTRINSIC
low complexity region 495 507 N/A INTRINSIC
low complexity region 514 522 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000077088
AA Change: F136L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000076341
Gene: ENSMUSG00000030254
AA Change: F136L

DomainStartEndE-ValueType
RING 25 63 3.12e-6 SMART
low complexity region 99 116 N/A INTRINSIC
ZnF_Rad18 201 224 3.61e-10 SMART
SAP 248 282 2.71e-11 SMART
PDB:2YBF|B 340 363 7e-6 PDB
internal_repeat_1 372 396 1.24e-14 PROSPERO
internal_repeat_1 396 420 1.24e-14 PROSPERO
low complexity region 447 462 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113180
AA Change: F136L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000108805
Gene: ENSMUSG00000030254
AA Change: F136L

DomainStartEndE-ValueType
RING 25 63 3.12e-6 SMART
low complexity region 99 116 N/A INTRINSIC
ZnF_Rad18 201 224 3.61e-10 SMART
SAP 248 282 2.71e-11 SMART
low complexity region 366 381 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113182
AA Change: F136L

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000108807
Gene: ENSMUSG00000030254
AA Change: F136L

DomainStartEndE-ValueType
RING 25 63 3.12e-6 SMART
low complexity region 99 116 N/A INTRINSIC
ZnF_Rad18 201 224 3.61e-10 SMART
SAP 248 282 2.71e-11 SMART
low complexity region 366 381 N/A INTRINSIC
low complexity region 388 400 N/A INTRINSIC
low complexity region 407 415 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132590
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135092
Predicted Effect probably benign
Transcript: ENSMUST00000156063
AA Change: F136L

PolyPhen 2 Score 0.158 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000138558
Gene: ENSMUSG00000030254
AA Change: F136L

DomainStartEndE-ValueType
RING 25 63 3.12e-6 SMART
low complexity region 99 116 N/A INTRINSIC
ZnF_Rad18 201 224 3.61e-10 SMART
SAP 248 282 2.71e-11 SMART
Meta Mutation Damage Score 0.0772 question?
Coding Region Coverage
  • 1x: 97.6%
  • 3x: 96.9%
  • 10x: 95.1%
  • 20x: 91.4%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is highly similar to S. cerevisiae DNA damage repair protein Rad18. Yeast Rad18 functions through its interaction with Rad6, which is an ubiquitin-conjugating enzyme required for post-replication repair of damaged DNA. Similar to its yeast counterpart, this protein is able to interact with the human homolog of yeast Rad6 protein through a conserved ring-finger motif. Mutation of this motif results in defective replication of UV-damaged DNA and hypersensitivity to multiple mutagens. [provided by RefSeq, Jul 2008]
PHENOTYPE: Male mice homozygous for a null allele exhibit age-dependent decrease in fertility, germ cell number, and testes weight with progressive degeneration of seminiferous tubules. [provided by MGI curators]
Allele List at MGI

 All alleles(6) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(4)

Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts16 G A 13: 70,779,518 probably benign Het
Ak7 G A 12: 105,742,332 V349M probably damaging Het
Aldh1a2 A T 9: 71,285,171 E436V possibly damaging Het
Apc C A 18: 34,317,022 P2290T probably damaging Het
Atp10a T C 7: 58,827,238 probably benign Het
Bahd1 T C 2: 118,915,923 S8P probably damaging Het
BC049715 C T 6: 136,840,308 P182L probably damaging Het
Capn10 T C 1: 92,934,955 Y28H probably benign Het
Ccdc129 A T 6: 55,968,304 D670V probably damaging Het
Cdh10 A T 15: 18,964,063 I104F probably damaging Het
Cep170b A G 12: 112,736,627 D508G possibly damaging Het
Ces2a G T 8: 104,740,824 A494S probably damaging Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Cltc G A 11: 86,733,727 T123M probably damaging Het
Cnot1 A G 8: 95,748,276 S1102P probably damaging Het
Col12a1 C A 9: 79,703,451 D224Y probably damaging Het
Col14a1 T A 15: 55,344,961 probably benign Het
Cyp7a1 T A 4: 6,272,848 T122S probably benign Het
Dock4 A G 12: 40,807,001 probably null Het
Eid2 T C 7: 28,268,499 V182A possibly damaging Het
Eloa A T 4: 136,010,770 V293D probably benign Het
Enkur G A 2: 21,194,295 P143S probably damaging Het
Ep300 T C 15: 81,626,347 Y99H probably damaging Het
Fbxw5 C A 2: 25,503,584 L66I probably benign Het
Flg2 A T 3: 93,203,621 R985S unknown Het
Fscb A T 12: 64,474,581 I37K possibly damaging Het
H2-M10.3 T C 17: 36,368,404 N3S probably benign Het
H2-Q7 A C 17: 35,439,626 Y80S probably damaging Het
H60c A T 10: 3,259,914 D124E possibly damaging Het
Hsd3b2 A T 3: 98,711,546 V361E probably damaging Het
Ice1 A C 13: 70,606,325 C547W probably damaging Het
Jmy A G 13: 93,498,795 V171A probably damaging Het
Klf7 C A 1: 64,079,213 R75L possibly damaging Het
Klk1b1 A T 7: 43,970,359 Q114L probably benign Het
Krt10 A G 11: 99,387,387 M280T possibly damaging Het
Lama1 G A 17: 67,802,921 R2179Q probably benign Het
Mbd3l1 C T 9: 18,484,929 P117S possibly damaging Het
Med18 A T 4: 132,460,109 S71R probably damaging Het
Mov10l1 T A 15: 89,011,404 I643N possibly damaging Het
Nfib T C 4: 82,498,589 K70E probably damaging Het
Nr3c2 A C 8: 76,908,329 S20R probably benign Het
Nr6a1 A T 2: 38,738,943 F356L probably benign Het
Oca2 G A 7: 56,328,785 R567H probably damaging Het
Olfr370 A G 8: 83,541,416 S91G probably benign Het
Olfr395 T A 11: 73,907,085 M136L possibly damaging Het
Olfr59 T C 11: 74,288,811 L55P probably damaging Het
Olfr794 T A 10: 129,570,828 Y58N probably damaging Het
Olfr952 T C 9: 39,426,958 T38A probably damaging Het
Pcdhb10 A G 18: 37,412,956 T362A probably benign Het
Pip5k1b A T 19: 24,397,040 V59E probably damaging Het
Pkhd1l1 G A 15: 44,547,509 probably null Het
Prr36 T C 8: 4,214,370 probably benign Het
Ptger2 A G 14: 45,001,771 T289A probably benign Het
Rhbg T A 3: 88,245,874 S258C probably damaging Het
Scgb2b27 T C 7: 34,013,314 I34M possibly damaging Het
Senp7 C A 16: 56,123,799 T135K probably damaging Het
Slc20a2 A G 8: 22,545,566 I193M probably damaging Het
Slc27a1 G A 8: 71,570,860 V47I probably benign Het
Slc9a5 G A 8: 105,368,134 V786M probably damaging Het
Smyd1 A G 6: 71,216,891 L350P probably damaging Het
Ston2 A T 12: 91,647,907 F576I probably damaging Het
Sulf2 A T 2: 166,082,678 V496E probably benign Het
Tcl1b3 C A 12: 105,191,222 S41Y probably damaging Het
Tulp2 A T 7: 45,519,777 N256I probably damaging Het
Uspl1 T A 5: 149,201,858 C349S probably damaging Het
Vcl T C 14: 21,020,536 I730T probably damaging Het
Vmn1r61 A T 7: 5,611,061 F85I probably benign Het
Zfp318 A G 17: 46,399,477 T709A probably benign Het
Zfr2 T C 10: 81,242,085 S249P probably damaging Het
Other mutations in Rad18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01577:Rad18 APN 6 112665341 splice site probably benign
IGL02425:Rad18 APN 6 112620898 missense probably damaging 1.00
IGL02622:Rad18 APN 6 112687987 missense probably damaging 0.99
IGL02814:Rad18 APN 6 112644622 missense possibly damaging 0.72
3-1:Rad18 UTSW 6 112681511 nonsense probably null
R0823:Rad18 UTSW 6 112665299 missense possibly damaging 0.80
R1220:Rad18 UTSW 6 112649664 nonsense probably null
R1351:Rad18 UTSW 6 112620902 missense possibly damaging 0.55
R1378:Rad18 UTSW 6 112681336 splice site probably benign
R1623:Rad18 UTSW 6 112628519 missense probably damaging 1.00
R2509:Rad18 UTSW 6 112675922 missense possibly damaging 0.93
R2893:Rad18 UTSW 6 112675773 nonsense probably null
R2894:Rad18 UTSW 6 112675773 nonsense probably null
R3017:Rad18 UTSW 6 112681366 missense possibly damaging 0.95
R3123:Rad18 UTSW 6 112681346 missense probably benign 0.41
R3755:Rad18 UTSW 6 112693471 missense probably damaging 1.00
R4392:Rad18 UTSW 6 112693529 missense probably damaging 1.00
R5285:Rad18 UTSW 6 112686765 missense probably benign 0.45
R5566:Rad18 UTSW 6 112681346 missense probably benign 0.41
R5958:Rad18 UTSW 6 112696642 unclassified probably benign
R6744:Rad18 UTSW 6 112675784 missense probably damaging 1.00
R7072:Rad18 UTSW 6 112681440 missense probably benign 0.01
R7247:Rad18 UTSW 6 112665325 missense possibly damaging 0.81
R7860:Rad18 UTSW 6 112649837 missense probably benign 0.01
R8223:Rad18 UTSW 6 112688021 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTCACAGGACCATTAGCATCCGAG -3'
(R):5'- ACAAATCCGAGAAGGTGCTCCCAG -3'

Sequencing Primer
(F):5'- TTAGCATCCGAGAGCCCC -3'
(R):5'- TCTGTGTTTCAGAGGAACCAAG -3'
Posted On2014-05-23