Phenotypic Mutation 'titan' (pdf version)
List |< first << previous [record 56 of 74] next >> last >|
Alleletitan
Mutation Type critical splice donor site (2 bp from exon)
Chromosome7
Coordinate46,783,469 bp (GRCm38)
Base Change A ⇒ G (forward strand)
Gene Hps5
Gene Name HPS5, biogenesis of lysosomal organelles complex 2 subunit 2
Synonym(s) ru-2, ru2, ruby eye 2
Chromosomal Location 46,760,466-46,796,064 bp (-)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may play a role in organelle biogenesis associated with melanosomes, platelet dense granules, and lysosomes. This protein interacts with Hermansky-Pudlak syndrome 6 protein and may interact with the cytoplasmic domain of integrin, alpha-3. Mutations in this gene are associated with Hermansky-Pudlak syndrome type 5. Multiple transcript variants encoding two distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes have hypopigmented eyes and hair, impaired secretion of lysosomal enzymes by renal proximal tubules and reduced clotting due to a platelet dense granule defect. Homozygotes for one allele are less susceptible to diet-induced atherosclerosis. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_001005247, NM_001167864; MGI: 2180307

Mapped Yes 
Amino Acid Change
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000014562] [ENSMUSP00000103280] [ENSMUSP00000103281] [ENSMUSP00000116770] [ENSMUSP00000122887] [ENSMUSP00000115786] [ENSMUSP00000147450]
SMART Domains Protein: ENSMUSP00000014562
Gene: ENSMUSG00000014418

DomainStartEndE-ValueType
SCOP:d1jjub_ 44 192 3e-8 SMART
Blast:WD40 63 103 7e-21 BLAST
Blast:WD40 111 151 1e-19 BLAST
low complexity region 429 449 N/A INTRINSIC
low complexity region 775 786 N/A INTRINSIC
low complexity region 989 998 N/A INTRINSIC
low complexity region 1021 1033 N/A INTRINSIC
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000103280
Gene: ENSMUSG00000014418

DomainStartEndE-ValueType
SCOP:d1jjub_ 44 192 3e-8 SMART
Blast:WD40 63 103 6e-21 BLAST
Blast:WD40 111 151 1e-19 BLAST
low complexity region 396 416 N/A INTRINSIC
low complexity region 742 753 N/A INTRINSIC
low complexity region 956 965 N/A INTRINSIC
low complexity region 988 1000 N/A INTRINSIC
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000103281
Gene: ENSMUSG00000014418

DomainStartEndE-ValueType
SCOP:d1jjub_ 44 192 3e-8 SMART
Blast:WD40 63 103 7e-21 BLAST
Blast:WD40 111 151 1e-19 BLAST
low complexity region 429 449 N/A INTRINSIC
low complexity region 775 786 N/A INTRINSIC
low complexity region 989 998 N/A INTRINSIC
low complexity region 1021 1033 N/A INTRINSIC
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000116770
Gene: ENSMUSG00000014418

DomainStartEndE-ValueType
SCOP:d1tbga_ 24 107 5e-4 SMART
Blast:WD40 63 103 1e-22 BLAST
Predicted Effect probably benign
SMART Domains Protein: ENSMUSP00000122887
Gene: ENSMUSG00000014418

DomainStartEndE-ValueType
SCOP:d1jjub_ 44 192 8e-8 SMART
Blast:WD40 63 103 9e-20 BLAST
Blast:WD40 111 151 2e-19 BLAST
low complexity region 429 449 N/A INTRINSIC
Predicted Effect probably benign
SMART Domains Protein: ENSMUSP00000115786
Gene: ENSMUSG00000014418

DomainStartEndE-ValueType
SCOP:d1jjub_ 44 192 2e-8 SMART
Blast:WD40 63 103 1e-21 BLAST
Blast:WD40 111 151 2e-20 BLAST
Predicted Effect probably benign
Predicted Effect probably benign
Predicted Effect probably benign
Phenotypic Category
Phenotypequestion? Literature verified References
dsDNA induced type I IFN production - increased
FACS CD11c+ DCs - decreased
FACS IgM MFI - decreased
impaired response to dsDNA- type I IFN production by macrophages
pigmentation 23672590
skin/coat/nails 23672590
Penetrance  
Alleles Listed at MGI

All mutations/alleles(77) : Chemically induced (ENU)(3) Gene trapped(66) Spontaneous(6) Targeted(2)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Hps5 APN 7 46775938 missense probably damaging 1.00
IGL00543:Hps5 APN 7 46778073 missense probably benign 0.37
IGL01090:Hps5 APN 7 46788327 missense probably benign 0.02
IGL01351:Hps5 APN 7 46761432 missense probably damaging 1.00
IGL01479:Hps5 APN 7 46762942 critical splice donor site probably null
IGL02056:Hps5 APN 7 46788182 missense probably damaging 1.00
IGL02117:Hps5 APN 7 46783516 missense probably damaging 1.00
IGL02210:Hps5 APN 7 46786570 missense probably benign 0.03
IGL02967:Hps5 APN 7 46769380 missense possibly damaging 0.69
IGL03046:Hps5 APN 7 46777039 splice site probably benign
IGL03187:Hps5 APN 7 46773207 missense probably damaging 1.00
IGL03259:Hps5 APN 7 46763102 missense probably damaging 0.99
dorian_gray UTSW 7 46784145 nonsense
smoky UTSW 7 46769351 nonsense probably null
toffee UTSW 7 46777075 critical splice donor site
R0068:Hps5 UTSW 7 46777042 splice site probably benign
R0068:Hps5 UTSW 7 46777042 splice site probably benign
R0141:Hps5 UTSW 7 46789181 missense probably damaging 1.00
R0383:Hps5 UTSW 7 46769288 splice site probably null
R0402:Hps5 UTSW 7 46790909 splice site probably benign
R0684:Hps5 UTSW 7 46783469 critical splice donor site probably null
R1159:Hps5 UTSW 7 46772554 unclassified probably null
R1938:Hps5 UTSW 7 46773267 missense probably damaging 1.00
R2058:Hps5 UTSW 7 46768051 missense probably damaging 1.00
R3613:Hps5 UTSW 7 46776874 critical splice donor site probably null
R3881:Hps5 UTSW 7 46771996 missense possibly damaging 0.54
R3882:Hps5 UTSW 7 46771996 missense possibly damaging 0.54
R3914:Hps5 UTSW 7 46783526 missense probably damaging 1.00
R4095:Hps5 UTSW 7 46775794 missense probably benign 0.01
R4457:Hps5 UTSW 7 46783613 missense probably benign 0.00
R4739:Hps5 UTSW 7 46786589 missense probably benign
R4838:Hps5 UTSW 7 46788354 missense probably damaging 1.00
R4934:Hps5 UTSW 7 46769351 nonsense probably null
R5876:Hps5 UTSW 7 46789196 missense probably damaging 1.00
R6056:Hps5 UTSW 7 46767097 missense probably benign 0.00
R6129:Hps5 UTSW 7 46771774 missense probably benign
R6878:Hps5 UTSW 7 46783634 missense probably damaging 1.00
X0021:Hps5 UTSW 7 46763093 missense probably damaging 1.00
Mode of Inheritance Autosomal Recessive
Local Stock Live Mice
MMRRC Submission 038259-MU
Last Updated 2016-11-01 10:15 AM by Katherine Timer
Record Created 2014-01-07 9:48 AM by Carlos Reyna
Record Posted 2015-01-13
Phenotypic Description
Figure 1. Phenotype of the titan mice.

The titan phenotype was identified among ENU-mutagenized G3 mice of the pedigree R0684, some of which showed hypopigmentation of the fur, pale colored ears, and pink feet and tail (Figure 1). The titan mice resemble mice of the ruby-eye 2 (ru2) strain (1).

Nature of Mutation

Whole exome HiSeq sequencing of the G1 grandsire identified 52 mutations.  A mutation in Hps5 was presumed to be causative because the titan phenotype mirrored the dorian gray and toffee phenotypes attributed to Hps5. The mutation in Hps5 is a T to C transition at base pair 46,783,469 (v38) on chromosome 7, or base pair 113,685 in the GenBank genomic region NC_000073.  The mutation is located within the donor splice site of intron 7, two nucleotides from the previous exon. Hps5 contains 23 total exons. The effect of the mutation at the cDNA and protein level is unknown. One possibility, shown below, is that aberrant splicing may result in skipping of the 213 base pair exon 7 and in-frame splicing from exon 6 to exon 8. This would result in deletion of 70 amino acids in the HPS5 protein; the deletion is not within a defined domain.

 

            <--exon 6        <--exon 7 intron 7-->     exon 8-->                <--exon 23

9542 ……TGTGACACCGAGAG ……GTGATCACTGCAAG gtagccgctacat…… ATCAGAGCCTCAGTAT…………TCGCAGCAGGCCTAG
200  ……-C--D--T--E--R ……-V--I--T--A--R                 --S--E--P--Q--Y-…………-S--Q--Q--A--*-
          correct           deleted                                    correct

 

Genomic numbering corresponds to NC_000073. The donor splice site of intron 7, which is destroyed by the mutation, is indicated in blue; the mutated nucleotide is indicated in red.

Protein Prediction

Figure 2. A, Predicted domains of HPS5. HPS5 contains two putative WD40 domains located at amino acids 65-105 and 113-153. The titan mutation, located in intron 7, results in deletion of exon 7 and in-frame splicing from exon 6 to exon 8. This image is interactive. Click on the image to view other mutations found in HPS5. Click on each mututation for more specific information. B, Components of the biogenesis of lysosomal-related organelle complex 2 (BLOC-2). All three proteins have been shown to co-immunoprecipitate, but only HSP5 and HSP6 bind together in two-hybrid studies suggesting the presence of unknown components of the complex (?).

HPS5 is an 1126 amino acid protein that forms part of the biogenesis of lysosome-related organelle complex 2 (BLOC-2; Figure 2). Other than the putative presence (with low statistical likelihood) of two WD40 domains at amino acids 65-105 and 113-153, sequence analysis of HPS5 reveals no known protein domains. The titan mutation does not occur within a defined domain in HPS5; the expression and localization of the HPS5titan protein have not been examined.

 

Please see the record for toffee for more information about Hps5.

Putative Mechanism

The precise molecular function of the BLOC-2 complex remains unknown. In addition to a yet undefined role in regulating lysosome and lysosome-related organelle secretion, HPS5 may also regulate protein trafficking during the maturation of melanosomes. Mutations of HPS5 were identified as the cause of the ruby-eye 2 (ru2) phenotype in mice and Hermansky-Pudlak syndrome 5 (HPS5; OMIM #614074) in humans. The mutant ruby-eye 2 phenotype in mice was named for its resemblance to the ruby-eye phenotype, characterized by diluted coat color that darkens with age, colorless eyes that darken with age to a ruby or maroon color, and platelet storage pool deficiency that causes prolonged bleeding time (2-4). HPS (OMIM #203300) was first described in 1959, and is now known to be a heterogeneous disorder with an array of clinical symptoms caused by alterations at numerous independent loci. HPS is characterized by oculocutaneous albinism (OCA), prolonged bleeding, and pulmonary fibrosis, conditions that arise from defects in the biogenesis and/or function of so-called lysosome-related organelles, such as melanosomes and platelet dense granules (5). Most of the genes associated with HPS encode subunits of protein complexes involved in intracellular trafficking. The phenotype of the titan mouse indicates that the mutant HPS5titan protein has impaired function leading to hypopigmentation in the mouse.

Primers PCR Primer
titan(F):5'- CCTAAGATGCAAGAGTTTGGGGAATGC -3'
titan(R):5'- ACAGGGTAACCATCCGTGCCATTG -3'

Sequencing Primer
titan_seq(F):5'- TCATACTGAGGCTCTGATCTAGAAGG -3'
titan_seq(R):5'- GTAGGTAAACCACCTTTGTCTTTG -3'
References
Science Writers Anne Murray
Illustrators Peter Jurek
AuthorsCarlos Reyna Tiana Purrington
List |< first << previous [record 56 of 74] next >> last >|