Phenotypic Mutation 'date2' (pdf version)
List |< first << previous [record 81 of 132] next >> last >|
Alleledate2
Mutation Type nonsense
Chromosome17
Coordinate34,214,032 bp (GRCm38)
Base Change C ⇒ A (forward strand)
Gene Tap2
Gene Name transporter 2, ATP-binding cassette, sub-family B (MDR/TAP)
Synonym(s) Abcb3, Ham-2, HAM2, Ham2, MTP2, PSF2, Tap-2
Chromosomal Location 34,203,527-34,216,321 bp (+)
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance. The protein encoded by this gene is involved in antigen presentation. This protein forms a heterodimer with Tap1 in order to transport peptides from the cytoplasm to the endoplasmic reticulum. Mutations in the human gene may be associated with ankylosing spondylitis, insulin-dependent diabetes mellitus, and celiac disease. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice have no CD8+ T cells, although their numbers of CD4+ T cells and B cells are normal. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_011530; MGI: 98484

Mapped Yes 
Limits of the Critical Region 34203527 - 34216321 bp
Amino Acid Change Tyrosine changed to Stop codon
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000025197] [ENSMUSP00000112395]
SMART Domains Protein: ENSMUSP00000025197
Gene: ENSMUSG00000024339
AA Change: Y429*

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
transmembrane domain 55 77 N/A INTRINSIC
transmembrane domain 97 119 N/A INTRINSIC
Pfam:ABC_membrane 151 419 1.8e-62 PFAM
AAA 494 678 2.58e-19 SMART
Predicted Effect probably null
Phenotypic Category
Phenotypequestion? Literature verified References
CD8 response - decreased
CTL killing - decreased
CTL killing dominant epitope - decreased
FACS B1a cells in B1 cells - decreased
FACS CD4:CD8 - increased
FACS CD4+ T cells - increased
FACS CD4+ T cells in CD3+ T cells - increased
FACS CD44+ CD4 MFI - decreased
FACS CD44+ CD8 MFI - increased
FACS CD44+ CD8 T cells - decreased
FACS CD8+ T cells - decreased 19721454
FACS CD8+ T cells in CD3+ T cells - decreased 19721454
FACS central memory CD8 T cells in CD8 T cells - increased
FACS effector memory CD4 T cells in CD4 T cells - decreased
FACS naive CD4 T cells in CD4 T cells - increased
FACS naive CD8 T cells in CD8 T cells - decreased
FACS NK cells - increased
NK cell response - decreased
NK killing - decreased
Penetrance  
Alleles Listed at MGI

All mutations/alleles(3) : Chemically induced (ENU)(3)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Tap2 APN 17 34215378 missense probably benign 0.09
IGL00802:Tap2 APN 17 34209130 missense probably damaging 0.96
IGL01291:Tap2 APN 17 34209210 missense probably benign 0.01
IGL01337:Tap2 APN 17 34205412 unclassified probably benign
IGL01549:Tap2 APN 17 34214329 missense probably benign 0.12
IGL02433:Tap2 APN 17 34205419 unclassified probably benign
IGL02488:Tap2 APN 17 34214642
IGL02657:Tap2 APN 17 34205458 missense probably damaging 0.99
IGL02677:Tap2 APN 17 34212047 missense probably benign 0.20
IGL03183:Tap2 APN 17 34205425 unclassified probably benign
date UTSW 17 34212354 missense probably damaging 0.99
ganymede UTSW 17 small insertion
hebe UTSW 17 small insertion
juventas UTSW 17 small insertion
3370:Tap2 UTSW 17 34209279 unclassified probably null
ANU05:Tap2 UTSW 17 34209210 missense probably benign 0.01
FR4976:Tap2 UTSW 17 34205699 unclassified probably benign
R0595:Tap2 UTSW 17 34212354 missense probably damaging 0.99
R0841:Tap2 UTSW 17 34215940 missense possibly damaging 0.64
R1145:Tap2 UTSW 17 34215940 missense possibly damaging 0.64
R1145:Tap2 UTSW 17 34215940 missense possibly damaging 0.64
R1296:Tap2 UTSW 17 34211915 missense probably benign 0.12
R1567:Tap2 UTSW 17 34214091 missense probably benign 0.00
R1656:Tap2 UTSW 17 34205953 missense possibly damaging 0.64
R1693:Tap2 UTSW 17 34209212 missense probably benign 0.00
R2246:Tap2 UTSW 17 34208801 missense possibly damaging 0.82
R2251:Tap2 UTSW 17 34211954 missense probably damaging 0.98
R2937:Tap2 UTSW 17 34212354 missense possibly damaging 0.80
R4682:Tap2 UTSW 17 34214032 nonsense probably null
R5262:Tap2 UTSW 17 34214016 missense probably benign
R6052:Tap2 UTSW 17 34214709 missense probably damaging 1.00
R6151:Tap2 UTSW 17 34212047 missense probably benign 0.00
R6196:Tap2 UTSW 17 34214410 missense possibly damaging 0.50
Mode of Inheritance Autosomal Recessive
Local Stock
Repository
Last Updated 2018-01-31 9:59 AM by Anne Murray
Record Created 2016-09-20 9:03 PM by Jin Huk Choi
Record Posted 2016-10-03
Phenotypic Description
Figure 1. Date2 mice exhibit an increase in the CD4+ to CD8+ T cell ratio. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Date2 mice exhibit increased frequencies of peripheral CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Date2 mice exhibit increased frequencies of peripheral CD4+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 4. Date2 mice exhibit reduced frequencies of peripheral effector memory CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 5. Date2 mice exhibit increased frequencies of peripheral naïve CD4+ T in CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 6. Date2 mice exhibit reduced frequencies of peripheral CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 7. Date2 mice exhibit reduced frequencies of peripheral CD8+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 8. Date2 mice exhibit reduced frequencies of peripheral naïve CD8+ T cells in CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 9. Date2 mice exhibit reduced frequencies of peripheral central memory CD8+ T cells in CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 10. Date2 mice exhibit reduced frequencies of peripheral CD44+ CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 11. Date2 mice exhibit a reduced CD44 MFI on CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 12. Date2 mice exhibit an increased CD44 MFI on CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 13. Date2 mice exhibit increased frequencies natural killer cells. Flow cytometric analysis of peripheral blood was utilized to determine NK cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The date2 phenotype was identified among G3 mice of the pedigree R4682, some of which showed an increase in in the CD4+ to CD8+ T cell ratio (Figure 1) caused by an increased frequency of CD4+ T cells (Figure 2), an increased frequency of CD4+ T cells in CD3+ T cells (Figure 3), a reduced frequency of effector memory CD4+ T cells in CD4 T cells (Figure 4), and an increased frequency of naive CD4+ T cells in CD4+ T cells (Figure 5) coupled with a reduced frequency of CD8+ T cells (Figure 6), a reduced frequency of CD8+ T cells in CD3+ T cells (Figure 7), a reduced frequency of naive CD8+ T cells in CD8+ T cells (Figure 8), and an increased frequency in central memory CD8+ T cells in CD8+ T cells (Figure 9), all in the peripheral blood. Some mice also showed a reduced frequency of CD44+ CD8+ T cells (Figure 10), a reduction in the CD44 mean fluorescence intensity (MFI) on peripheral blood CD4+ T cells (Figure 11) and CD8+ T cells (Figure 12) as well as increased frequencies of natural killer cells in the peripheral blood (Figure 13).

Nature of Mutation

Figure 14. Linkage mapping of the reduced frequency of CD8+ T cells in CD3+ T cells using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 40 mutations (X-axis) identified in the G1 male of pedigree R4682. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity.  Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 40 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Tap2:  a C to A transversion at base pair 34,214,032 (v38) on chromosome 17, or base pair 9,554 in the GenBank genomic region NC_000083 encoding Tap2. The strongest association was found with a recessive model of linkage to the normalized frequency of CD8+ T cells in CD3+ T cells, wherein 15 variant homozygotes departed phenotypically from 8 homozygous reference mice and 20 heterozygous mice with a P value of 8.881 x 10-23 (Figure 14).  A substantial semidominant effect was observed in most of the assays but the mutation is preponderantly recessive, and in no assay was a purely dominant effect observed. 

 

The mutation corresponds to residue 1,440 in the mRNA sequence NM_011530 within exon 8 of 12 total exons.


 
1423 AACCTGGTTTACATGTACGGGGATATGCTGAGC
424  -N--L--V--Y--M--Y--G--D--M--L--S-

 

The mutated nucleotide is indicated in red.  The mutation results in substitution of tyrosine 429 for a premature stop codon (Y429*) in the TAP2 protein.

Protein Prediction

Figure 15. Predicted membrane topology of TAP. Both TAP1 and TAP2 contain a 6-helix core transmembrane domain (TMD; purple) and a cytosolic nucleotide binding domain (NBD). Tapasin binding N-terminal accessory domains (pink) consist of 4 and 3 transmembrane helices for TAP1 and TAP2, respectively. The Walker A (A), Walker B (B), and signature/C-loop motif (C) sequences, involved in ATP biding and/or hydrolysis, and color coded to indicate to which ATPase site they belong (green = consensus site,; orange = degenerate site). The date2 mutation is indicated. The image is interactive, click to view another Tap2 mutation.

The transporter associated with antigen processing (TAP) pumps cytosolic peptides into the endoplasmic reticulum (ER) lumen for loading onto class I major histocompatibility (MHC) molecules and presentation to T lymphocytes. TAP is a member of the ATP-binding cassette (ABC) transporter family, ubiquitous proteins that shuttle a variety of substrates, including ions, sugars, amino acids, peptides, vitamins, lipids, antibiotics, and drugs, across cellular membranes (1;2). TAP is a heterodimer of the homologous TAP1 (724 amino acids in mice) and TAP2 proteins (702 amino acids in mice), each of which contains a six-helix TMD, a C-terminal NBD, and three transmembrane N-terminal accessory domains (Figure 15). The date2 mutation results in substitution of tyrosine 429 for a premature stop codon. Tyr429 is located within the cytoplasmic C-terminal tail immediately following the last transmembrane domain.

 

Please see the record for ganymede for information about Tap2.

Putative Mechanism

TAP is essential for the transport of peptides into the ER for loading onto MHC class I molecules and display at the cell surface. Peptide binding is required to stabilize MHC class I molecules, so mice with disrupted TAP1 or TAP2 genes assemble drastically reduced amounts of MHC class I molecules, and have nearly absent surface expression of MHC class I.  The cells of Tap1-/- mice (3) and mice with an ENU-induced point mutation in TAP2 (Tap2jasmine) (4) are deficient in cytosolic antigen presentation, and consequently CD8+ T cells fail to develop in these animals. Similarly, human mutations in TAP1 (5;6), TAP2 (7;8), or tapasin (9) cause the rarely occurring bare lymphocyte syndrome type I (type I BLS, OMIM #604571), characterized a reduction in MHC class I surface expression to 1-3% of normal levels. The lack of CD8+ T cells in date2 is due to death after failure to interact with peptide-MHC class I in the thymus, which is known to promote the development and maintenance of these T cells. 

Primers PCR Primer
date2(F):5'- TCCAAGGTTCCCTCTCTGAG -3'
date2(R):5'- GAAAATGATGTTCAGGCTGCG -3'

Sequencing Primer
date2_seq(F):5'- AAGGTTCCCTCTCTGAGTTTATCCG -3'
date2_seq(R):5'- GAGAAAGGTTCCGATCCCACG -3'
References
Science Writers Anne Murray
Illustrators Diantha La Vine, Katherine Timer
AuthorsMing Zeng, Xue Zhong, Bruce Beutler
List |< first << previous [record 81 of 132] next >> last >|