Incidental Mutation 'R1257:Shf'
ID151484
Institutional Source Beutler Lab
Gene Symbol Shf
Ensembl Gene ENSMUSG00000033256
Gene NameSrc homology 2 domain containing F
Synonyms
MMRRC Submission 039324-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.282) question?
Stock #R1257 (G1)
Quality Score89
Status Not validated
Chromosome2
Chromosomal Location122348892-122369162 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 122368682 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 51 (P51S)
Ref Sequence ENSEMBL: ENSMUSP00000106161 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048635] [ENSMUST00000110531] [ENSMUST00000110532] [ENSMUST00000125826]
Predicted Effect probably benign
Transcript: ENSMUST00000048635
SMART Domains Protein: ENSMUSP00000045135
Gene: ENSMUSG00000033256

DomainStartEndE-ValueType
low complexity region 48 67 N/A INTRINSIC
SH2 136 220 9.16e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110531
SMART Domains Protein: ENSMUSP00000106160
Gene: ENSMUSG00000033256

DomainStartEndE-ValueType
low complexity region 48 67 N/A INTRINSIC
SH2 136 220 9.16e-27 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110532
AA Change: P51S

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000106161
Gene: ENSMUSG00000033256
AA Change: P51S

DomainStartEndE-ValueType
low complexity region 19 38 N/A INTRINSIC
low complexity region 45 61 N/A INTRINSIC
low complexity region 77 87 N/A INTRINSIC
low complexity region 146 165 N/A INTRINSIC
Blast:SH2 225 278 2e-22 BLAST
SCOP:d1ayaa_ 237 291 1e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125826
AA Change: P161S

PolyPhen 2 Score 0.433 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000117099
Gene: ENSMUSG00000033256
AA Change: P161S

DomainStartEndE-ValueType
low complexity region 14 56 N/A INTRINSIC
low complexity region 76 105 N/A INTRINSIC
low complexity region 129 148 N/A INTRINSIC
low complexity region 155 171 N/A INTRINSIC
low complexity region 187 197 N/A INTRINSIC
low complexity region 256 275 N/A INTRINSIC
SH2 344 428 9.16e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000151130
AA Change: P152S

PolyPhen 2 Score 0.251 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000114524
Gene: ENSMUSG00000033256
AA Change: P152S

DomainStartEndE-ValueType
low complexity region 6 48 N/A INTRINSIC
low complexity region 68 97 N/A INTRINSIC
low complexity region 121 140 N/A INTRINSIC
low complexity region 147 163 N/A INTRINSIC
low complexity region 179 189 N/A INTRINSIC
low complexity region 248 267 N/A INTRINSIC
Meta Mutation Damage Score 0.062 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024P04Rik A T 13: 98,984,515 M1K probably null Het
Acoxl A T 2: 128,044,366 T174S probably benign Het
Ank3 C T 10: 69,874,835 R408* probably null Het
Ceacam15 A G 7: 16,672,024 S201P possibly damaging Het
Ceacam20 A G 7: 19,974,192 I241V probably benign Het
Cfap46 A T 7: 139,654,629 L237* probably null Het
Col4a3 T A 1: 82,716,365 C133S probably damaging Het
Dnajc9 G A 14: 20,388,697 probably null Het
Dnhd1 T A 7: 105,694,153 V1568D probably damaging Het
Fam208b T C 13: 3,575,049 T1634A probably benign Het
Gli3 C T 13: 15,725,996 Q1323* probably null Het
Gm884 A G 11: 103,534,641 V1462A unknown Het
Grhpr A G 4: 44,989,045 N287S probably damaging Het
Hectd4 G A 5: 121,318,624 W684* probably null Het
Kifc3 A G 8: 95,105,772 V474A probably damaging Het
Mdn1 A T 4: 32,667,089 probably null Het
Med7 C G 11: 46,440,633 I18M probably damaging Het
Nid1 T C 13: 13,483,790 Y707H probably benign Het
Nol4 A T 18: 22,770,681 N339K probably damaging Het
Olfr799 A T 10: 129,647,544 K139* probably null Het
Rbm34 C T 8: 126,970,893 G23S possibly damaging Het
Rps19bp1 CCTTCTTCTTCTTCTTCTTCTT CCTTCTTCTTCTTCTTCTT 15: 80,261,049 probably benign Het
Snap25 A T 2: 136,758,348 E37V probably damaging Het
Taf1a A G 1: 183,397,837 T118A possibly damaging Het
Thrb T A 14: 18,008,642 I122K probably damaging Het
Xkr4 T G 1: 3,216,813 I385L probably benign Het
Zeb1 G T 18: 5,772,699 R996L possibly damaging Het
Other mutations in Shf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02726:Shf APN 2 122359488 missense probably damaging 1.00
FR4589:Shf UTSW 2 122354177 small insertion probably benign
R0624:Shf UTSW 2 122368635 splice site probably benign
R0993:Shf UTSW 2 122368682 missense probably damaging 0.96
R1180:Shf UTSW 2 122368682 missense probably damaging 0.96
R1181:Shf UTSW 2 122368682 missense probably damaging 0.96
R1193:Shf UTSW 2 122368682 missense probably damaging 0.96
R1194:Shf UTSW 2 122368682 missense probably damaging 0.96
R1195:Shf UTSW 2 122368682 missense probably damaging 0.96
R1195:Shf UTSW 2 122368682 missense probably damaging 0.96
R1258:Shf UTSW 2 122368682 missense probably damaging 0.96
R1260:Shf UTSW 2 122368682 missense probably damaging 0.96
R1267:Shf UTSW 2 122368682 missense probably damaging 0.96
R1268:Shf UTSW 2 122368682 missense probably damaging 0.96
R1269:Shf UTSW 2 122368682 missense probably damaging 0.96
R1270:Shf UTSW 2 122368682 missense probably damaging 0.96
R1271:Shf UTSW 2 122368682 missense probably damaging 0.96
R1273:Shf UTSW 2 122368682 missense probably damaging 0.96
R1388:Shf UTSW 2 122368682 missense probably damaging 0.96
R1448:Shf UTSW 2 122368682 missense probably damaging 0.96
R1494:Shf UTSW 2 122368682 missense probably damaging 0.96
R1615:Shf UTSW 2 122349432 missense probably damaging 1.00
R1697:Shf UTSW 2 122368682 missense probably damaging 0.96
R1756:Shf UTSW 2 122368682 missense probably damaging 0.96
R1820:Shf UTSW 2 122368682 missense probably damaging 0.96
R1950:Shf UTSW 2 122368682 missense probably damaging 0.96
R3732:Shf UTSW 2 122345207 unclassified probably benign
R6794:Shf UTSW 2 122353840 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCTAACAGGAAACAGGGCAGAGTT -3'
(R):5'- CAGCGGTGGAGTCGCAAAGT -3'

Sequencing Primer
(F):5'- GGTTAAAATTTGAGCCCCCG -3'
(R):5'- GAGCACCTGGGCTTTCG -3'
Posted On2014-01-29