Incidental Mutation 'R6794:Shf'
ID531655
Institutional Source Beutler Lab
Gene Symbol Shf
Ensembl Gene ENSMUSG00000033256
Gene NameSrc homology 2 domain containing F
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6794 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location122348892-122369162 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 122353840 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 234 (L234P)
Ref Sequence ENSEMBL: ENSMUSP00000119980 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048635] [ENSMUST00000110530] [ENSMUST00000110531] [ENSMUST00000110532] [ENSMUST00000121237] [ENSMUST00000125826] [ENSMUST00000139819]
Predicted Effect probably damaging
Transcript: ENSMUST00000048635
AA Change: L152P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000045135
Gene: ENSMUSG00000033256
AA Change: L152P

DomainStartEndE-ValueType
low complexity region 48 67 N/A INTRINSIC
SH2 136 220 9.16e-27 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110530
AA Change: L146P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106159
Gene: ENSMUSG00000033256
AA Change: L146P

DomainStartEndE-ValueType
low complexity region 42 61 N/A INTRINSIC
SH2 130 214 9.16e-27 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110531
AA Change: L152P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106160
Gene: ENSMUSG00000033256
AA Change: L152P

DomainStartEndE-ValueType
low complexity region 48 67 N/A INTRINSIC
SH2 136 220 9.16e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110532
SMART Domains Protein: ENSMUSP00000106161
Gene: ENSMUSG00000033256

DomainStartEndE-ValueType
low complexity region 19 38 N/A INTRINSIC
low complexity region 45 61 N/A INTRINSIC
low complexity region 77 87 N/A INTRINSIC
low complexity region 146 165 N/A INTRINSIC
Blast:SH2 225 278 2e-22 BLAST
SCOP:d1ayaa_ 237 291 1e-6 SMART
Predicted Effect silent
Transcript: ENSMUST00000121237
SMART Domains Protein: ENSMUSP00000113923
Gene: ENSMUSG00000033256

DomainStartEndE-ValueType
low complexity region 42 61 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000125826
AA Change: L360P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117099
Gene: ENSMUSG00000033256
AA Change: L360P

DomainStartEndE-ValueType
low complexity region 14 56 N/A INTRINSIC
low complexity region 76 105 N/A INTRINSIC
low complexity region 129 148 N/A INTRINSIC
low complexity region 155 171 N/A INTRINSIC
low complexity region 187 197 N/A INTRINSIC
low complexity region 256 275 N/A INTRINSIC
SH2 344 428 9.16e-27 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000139819
AA Change: L234P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119980
Gene: ENSMUSG00000033256
AA Change: L234P

DomainStartEndE-ValueType
low complexity region 14 24 N/A INTRINSIC
low complexity region 83 102 N/A INTRINSIC
low complexity region 149 163 N/A INTRINSIC
SH2 218 302 9.16e-27 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000143484
AA Change: L86P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000120732
Gene: ENSMUSG00000033256
AA Change: L86P

DomainStartEndE-ValueType
low complexity region 14 33 N/A INTRINSIC
SH2 71 155 3.19e-26 SMART
Predicted Effect silent
Transcript: ENSMUST00000151130
SMART Domains Protein: ENSMUSP00000114524
Gene: ENSMUSG00000033256

DomainStartEndE-ValueType
low complexity region 6 48 N/A INTRINSIC
low complexity region 68 97 N/A INTRINSIC
low complexity region 121 140 N/A INTRINSIC
low complexity region 147 163 N/A INTRINSIC
low complexity region 179 189 N/A INTRINSIC
low complexity region 248 267 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.4%
Validation Efficiency 100% (37/37)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik A G 1: 37,637,855 probably null Het
Agxt T C 1: 93,135,382 V30A possibly damaging Het
Atf7 T C 15: 102,557,465 K87E probably benign Het
Btg4 A C 9: 51,119,351 K250N possibly damaging Het
Cyc1 A G 15: 76,344,650 Y132C probably damaging Het
Dcaf5 A T 12: 80,398,893 D137E possibly damaging Het
Ddr2 C A 1: 169,982,098 W770L probably damaging Het
Disc1 T C 8: 125,087,775 V126A probably benign Het
Dock8 A G 19: 25,122,441 N643D probably benign Het
Gabrg1 C T 5: 70,815,971 R75H probably damaging Het
Gm14418 A T 2: 177,387,838 H121Q probably damaging Het
H2-Ob T A 17: 34,241,188 L20Q possibly damaging Het
Herpud1 T A 8: 94,394,770 probably null Het
Ica1 T C 6: 8,653,659 D326G probably benign Het
Jph3 T C 8: 121,785,385 L704P probably benign Het
Kmt2e TGCCGCCGCCGCCGCCACCGCCGCCGCCGC TGCCGCCGCCGCCGCCGCCACCGCCGCCGCCGC 5: 23,499,476 probably benign Het
Lnpep T G 17: 17,531,159 N948T probably damaging Het
Mdn1 T A 4: 32,741,893 V3888D probably damaging Het
Muc5ac T C 7: 141,809,552 probably benign Het
Nfkb2 T C 19: 46,307,720 probably null Het
Pik3r2 T C 8: 70,770,717 H380R probably benign Het
Prim1 T C 10: 128,018,149 S124P probably damaging Het
Prokr1 T C 6: 87,588,693 T57A possibly damaging Het
Ptpn4 T C 1: 119,743,390 T213A probably damaging Het
Sapcd2 A G 2: 25,376,367 S389G probably damaging Het
Scn5a T C 9: 119,535,889 Q421R probably damaging Het
Serac1 A G 17: 6,051,710 Y430H probably damaging Het
Slc22a29 G T 19: 8,161,523 S525Y probably benign Het
Thbs1 A G 2: 118,120,038 probably null Het
Tln2 T C 9: 67,286,558 D666G probably benign Het
Ubqlnl C T 7: 104,148,785 E502K probably benign Het
Uhrf1bp1l T C 10: 89,805,762 S932P probably benign Het
Vmn2r118 T A 17: 55,592,348 H852L possibly damaging Het
Vmn2r72 A G 7: 85,737,996 F787L probably damaging Het
Xpc G A 6: 91,506,857 A169V probably benign Het
Ylpm1 A G 12: 84,996,881 H131R unknown Het
Other mutations in Shf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02726:Shf APN 2 122359488 missense probably damaging 1.00
FR4589:Shf UTSW 2 122354177 small insertion probably benign
R0624:Shf UTSW 2 122368635 splice site probably benign
R0993:Shf UTSW 2 122368682 missense probably damaging 0.96
R1180:Shf UTSW 2 122368682 missense probably damaging 0.96
R1181:Shf UTSW 2 122368682 missense probably damaging 0.96
R1193:Shf UTSW 2 122368682 missense probably damaging 0.96
R1194:Shf UTSW 2 122368682 missense probably damaging 0.96
R1195:Shf UTSW 2 122368682 missense probably damaging 0.96
R1195:Shf UTSW 2 122368682 missense probably damaging 0.96
R1257:Shf UTSW 2 122368682 missense probably damaging 0.96
R1258:Shf UTSW 2 122368682 missense probably damaging 0.96
R1260:Shf UTSW 2 122368682 missense probably damaging 0.96
R1267:Shf UTSW 2 122368682 missense probably damaging 0.96
R1268:Shf UTSW 2 122368682 missense probably damaging 0.96
R1269:Shf UTSW 2 122368682 missense probably damaging 0.96
R1270:Shf UTSW 2 122368682 missense probably damaging 0.96
R1271:Shf UTSW 2 122368682 missense probably damaging 0.96
R1273:Shf UTSW 2 122368682 missense probably damaging 0.96
R1388:Shf UTSW 2 122368682 missense probably damaging 0.96
R1448:Shf UTSW 2 122368682 missense probably damaging 0.96
R1494:Shf UTSW 2 122368682 missense probably damaging 0.96
R1615:Shf UTSW 2 122349432 missense probably damaging 1.00
R1697:Shf UTSW 2 122368682 missense probably damaging 0.96
R1756:Shf UTSW 2 122368682 missense probably damaging 0.96
R1820:Shf UTSW 2 122368682 missense probably damaging 0.96
R1950:Shf UTSW 2 122368682 missense probably damaging 0.96
R3732:Shf UTSW 2 122345207 unclassified probably benign
R7414:Shf UTSW 2 122359582 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- GCCAGCAGTTGTTCAAAGG -3'
(R):5'- CTCTGGAAAACCAGGTGTGAG -3'

Sequencing Primer
(F):5'- CCAGCAGTTGTTCAAAGGGCATC -3'
(R):5'- AAACCAGGTGTGAGTGTCTG -3'
Posted On2018-08-29