Incidental Mutation 'R1494:Shf'
ID163800
Institutional Source Beutler Lab
Gene Symbol Shf
Ensembl Gene ENSMUSG00000033256
Gene NameSrc homology 2 domain containing F
Synonyms
MMRRC Submission 039545-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.282) question?
Stock #R1494 (G1)
Quality Score85
Status Validated
Chromosome2
Chromosomal Location122348892-122369162 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 122368682 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 51 (P51S)
Ref Sequence ENSEMBL: ENSMUSP00000106161 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048635] [ENSMUST00000110531] [ENSMUST00000110532] [ENSMUST00000125826]
Predicted Effect probably benign
Transcript: ENSMUST00000048635
SMART Domains Protein: ENSMUSP00000045135
Gene: ENSMUSG00000033256

DomainStartEndE-ValueType
low complexity region 48 67 N/A INTRINSIC
SH2 136 220 9.16e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110531
SMART Domains Protein: ENSMUSP00000106160
Gene: ENSMUSG00000033256

DomainStartEndE-ValueType
low complexity region 48 67 N/A INTRINSIC
SH2 136 220 9.16e-27 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110532
AA Change: P51S

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000106161
Gene: ENSMUSG00000033256
AA Change: P51S

DomainStartEndE-ValueType
low complexity region 19 38 N/A INTRINSIC
low complexity region 45 61 N/A INTRINSIC
low complexity region 77 87 N/A INTRINSIC
low complexity region 146 165 N/A INTRINSIC
Blast:SH2 225 278 2e-22 BLAST
SCOP:d1ayaa_ 237 291 1e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125826
AA Change: P161S

PolyPhen 2 Score 0.433 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000117099
Gene: ENSMUSG00000033256
AA Change: P161S

DomainStartEndE-ValueType
low complexity region 14 56 N/A INTRINSIC
low complexity region 76 105 N/A INTRINSIC
low complexity region 129 148 N/A INTRINSIC
low complexity region 155 171 N/A INTRINSIC
low complexity region 187 197 N/A INTRINSIC
low complexity region 256 275 N/A INTRINSIC
SH2 344 428 9.16e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000151130
AA Change: P152S

PolyPhen 2 Score 0.251 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000114524
Gene: ENSMUSG00000033256
AA Change: P152S

DomainStartEndE-ValueType
low complexity region 6 48 N/A INTRINSIC
low complexity region 68 97 N/A INTRINSIC
low complexity region 121 140 N/A INTRINSIC
low complexity region 147 163 N/A INTRINSIC
low complexity region 179 189 N/A INTRINSIC
low complexity region 248 267 N/A INTRINSIC
Meta Mutation Damage Score 0.062 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 91.3%
Validation Efficiency 97% (57/59)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700067P10Rik A G 17: 48,090,471 E92G probably benign Het
Abca13 C T 11: 9,466,429 Q4064* probably null Het
Abca14 G A 7: 120,216,301 M257I probably benign Het
Acsm2 T A 7: 119,575,632 C207S probably damaging Het
Actr3 A G 1: 125,416,281 I67T probably benign Het
Adcy7 T C 8: 88,320,207 V606A probably benign Het
Ahnak2 G A 12: 112,787,950 S54F probably damaging Het
Ano6 T C 15: 95,972,507 S848P probably damaging Het
Atg3 C T 16: 45,171,760 probably benign Het
Atp8b1 T A 18: 64,564,526 S416C probably damaging Het
C2cd5 A G 6: 143,041,346 probably benign Het
Capn11 A T 17: 45,643,809 V134E probably damaging Het
Ccnd3 A G 17: 47,598,108 probably null Het
Chaf1b T A 16: 93,888,110 V149E probably damaging Het
Col5a2 T A 1: 45,502,914 M1L unknown Het
Copa T C 1: 172,104,127 I315T probably benign Het
Cyp3a57 A G 5: 145,381,267 M353V probably damaging Het
Dcaf6 T C 1: 165,333,373 M828V probably damaging Het
Dock2 T A 11: 34,282,761 K1080* probably null Het
Dock6 A G 9: 21,814,742 V1424A probably benign Het
Foxa1 T C 12: 57,542,198 D412G probably damaging Het
Foxp4 G C 17: 47,880,353 probably benign Het
Galnt9 T A 5: 110,588,330 S171T probably damaging Het
Glt6d1 A G 2: 25,794,248 Y249H probably damaging Het
Gm37240 A T 3: 84,527,691 Y104N probably damaging Het
Gpx8 C T 13: 113,045,615 E95K possibly damaging Het
Grm1 T C 10: 10,689,706 T953A probably benign Het
Helz T C 11: 107,604,063 probably benign Het
Hif3a T C 7: 17,054,722 Y108C probably damaging Het
Kcnj13 A T 1: 87,389,217 L58Q probably damaging Het
Mfsd14b A T 13: 65,095,671 V53D probably damaging Het
Mrps7 G C 11: 115,604,126 probably benign Het
Mug1 G A 6: 121,879,300 G1013D probably damaging Het
Olfr652 T A 7: 104,564,831 Y203* probably null Het
Olfr767 A T 10: 129,079,615 M116K probably damaging Het
Pax6 T C 2: 105,691,610 I19T probably benign Het
Pde8b G A 13: 95,047,796 R416C probably damaging Het
Prl2c2 G C 13: 13,002,201 T47R probably damaging Het
Pygl G A 12: 70,199,730 R348W probably damaging Het
Ralgapa1 T A 12: 55,684,524 D1874V probably damaging Het
Sncaip T C 18: 52,868,886 S160P probably damaging Het
Sptbn4 A G 7: 27,434,294 V79A probably damaging Het
Sptlc3 A T 2: 139,589,560 Y334F possibly damaging Het
Supt16 A G 14: 52,172,459 Y764H probably benign Het
Syne3 A T 12: 104,955,582 V438E possibly damaging Het
Tagap1 T C 17: 6,956,811 D162G probably damaging Het
Terb1 T C 8: 104,498,490 probably benign Het
Themis3 C A 17: 66,559,954 R97L probably benign Het
Tnk1 T A 11: 69,856,546 E86D possibly damaging Het
Tnpo3 A G 6: 29,557,044 L53P probably damaging Het
Trpc6 G A 9: 8,658,304 R725K probably benign Het
Ttll11 T G 2: 35,795,379 T566P probably damaging Het
Unc5c A T 3: 141,827,549 T779S possibly damaging Het
Zfp42 A G 8: 43,295,601 C288R possibly damaging Het
Zfp763 G A 17: 33,021,503 T52I probably damaging Het
Other mutations in Shf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02726:Shf APN 2 122359488 missense probably damaging 1.00
FR4589:Shf UTSW 2 122354177 small insertion probably benign
R0624:Shf UTSW 2 122368635 splice site probably benign
R0993:Shf UTSW 2 122368682 missense probably damaging 0.96
R1180:Shf UTSW 2 122368682 missense probably damaging 0.96
R1181:Shf UTSW 2 122368682 missense probably damaging 0.96
R1193:Shf UTSW 2 122368682 missense probably damaging 0.96
R1194:Shf UTSW 2 122368682 missense probably damaging 0.96
R1195:Shf UTSW 2 122368682 missense probably damaging 0.96
R1195:Shf UTSW 2 122368682 missense probably damaging 0.96
R1257:Shf UTSW 2 122368682 missense probably damaging 0.96
R1258:Shf UTSW 2 122368682 missense probably damaging 0.96
R1260:Shf UTSW 2 122368682 missense probably damaging 0.96
R1267:Shf UTSW 2 122368682 missense probably damaging 0.96
R1268:Shf UTSW 2 122368682 missense probably damaging 0.96
R1269:Shf UTSW 2 122368682 missense probably damaging 0.96
R1270:Shf UTSW 2 122368682 missense probably damaging 0.96
R1271:Shf UTSW 2 122368682 missense probably damaging 0.96
R1273:Shf UTSW 2 122368682 missense probably damaging 0.96
R1388:Shf UTSW 2 122368682 missense probably damaging 0.96
R1448:Shf UTSW 2 122368682 missense probably damaging 0.96
R1615:Shf UTSW 2 122349432 missense probably damaging 1.00
R1697:Shf UTSW 2 122368682 missense probably damaging 0.96
R1756:Shf UTSW 2 122368682 missense probably damaging 0.96
R1820:Shf UTSW 2 122368682 missense probably damaging 0.96
R1950:Shf UTSW 2 122368682 missense probably damaging 0.96
R3732:Shf UTSW 2 122345207 unclassified probably benign
R6794:Shf UTSW 2 122353840 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCTAACAGGAAACAGGGCAGAGTT -3'
(R):5'- CAGCGGTGGAGTCGCAAAGT -3'

Sequencing Primer
(F):5'- GGTTAAAATTTGAGCCCCCG -3'
(R):5'- GAGCACCTGGGCTTTCG -3'
Posted On2014-03-28