Incidental Mutation 'R1239:Olfr1463'
ID151906
Institutional Source Beutler Lab
Gene Symbol Olfr1463
Ensembl Gene ENSMUSG00000096365
Gene Nameolfactory receptor 1463
SynonymsMOR202-29P, GA_x6K02T2RE5P-3560863-3561795
MMRRC Submission 039306-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R1239 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location13231328-13236400 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 13234676 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 142 (C142Y)
Ref Sequence ENSEMBL: ENSMUSP00000146566 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064102] [ENSMUST00000207246]
Predicted Effect possibly damaging
Transcript: ENSMUST00000064102
AA Change: C142Y

PolyPhen 2 Score 0.803 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000070872
Gene: ENSMUSG00000096365
AA Change: C142Y

DomainStartEndE-ValueType
Pfam:7tm_4 32 310 1e-51 PFAM
Pfam:7TM_GPCR_Srsx 36 306 3.2e-6 PFAM
Pfam:7tm_1 42 291 1.4e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000207246
AA Change: C142Y

PolyPhen 2 Score 0.803 (Sensitivity: 0.84; Specificity: 0.93)
Meta Mutation Damage Score 0.396 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530077C05Rik GTTCTTC GTTC 9: 22,424,699 probably benign Het
Actn3 C T 19: 4,865,455 probably benign Het
Adcy8 G T 15: 64,716,062 R959S probably damaging Het
Ank1 A G 8: 23,096,155 N455D probably damaging Het
Ankrd17 T C 5: 90,288,676 T589A probably damaging Het
BC022687 A G 12: 112,809,503 R39G probably benign Het
Cacna1c C T 6: 118,612,625 R1446H probably damaging Het
Celsr1 G T 15: 85,979,146 N1228K probably damaging Het
Ces4a T C 8: 105,149,498 L557P probably damaging Het
Chd1l C T 3: 97,582,731 E503K probably benign Het
Col27a1 T C 4: 63,318,915 probably benign Het
Cplx2 G T 13: 54,379,602 A100S probably damaging Het
Cpsf6 G A 10: 117,361,343 probably benign Het
Cyp1a2 A G 9: 57,681,767 F255L probably benign Het
D10Jhu81e A G 10: 78,168,927 probably benign Het
Dnajc6 T C 4: 101,635,116 Y783H probably damaging Het
E230025N22Rik T C 18: 36,685,475 I434V probably damaging Het
Ermap T C 4: 119,188,925 K3E probably benign Het
Gm14139 T C 2: 150,191,971 Y71H possibly damaging Het
Gstm2 G A 3: 107,984,028 L125F possibly damaging Het
Hk2 C T 6: 82,749,308 G58R probably damaging Het
Jpt2 T C 17: 24,960,611 M1V probably null Het
Mgmt T C 7: 137,128,057 F200S probably benign Het
Mug2 T G 6: 122,081,678 probably benign Het
Olfr1368 C T 13: 21,142,167 V297I probably benign Het
Olfr235 G T 19: 12,268,976 V249F probably damaging Het
Parp14 G A 16: 35,856,760 A946V probably benign Het
Phc3 A G 3: 30,914,130 V886A probably damaging Het
Plcg2 T A 8: 117,556,044 V88D probably benign Het
Podxl2 C T 6: 88,849,983 V50I probably benign Het
Rap1gap G T 4: 137,717,996 M329I probably damaging Het
Rbm5 A G 9: 107,752,966 probably benign Het
Robo1 A G 16: 73,024,542 probably null Het
Ryr2 A T 13: 11,883,043 probably null Het
Skida1 A C 2: 18,047,317 probably benign Het
Tecta A G 9: 42,332,485 F2024L probably damaging Het
Trim43a GATTTATTTATTTATTTATTTATTTATTTATTTATTTATT GATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATT 9: 88,582,989 probably benign Het
Vmn1r16 C T 6: 57,323,633 M1I probably null Het
Zbtb39 G T 10: 127,743,069 G504V probably damaging Het
Zfp106 A T 2: 120,533,594 N777K probably damaging Het
Other mutations in Olfr1463
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01131:Olfr1463 APN 19 13234739 missense probably benign 0.01
IGL02596:Olfr1463 APN 19 13234399 missense probably damaging 1.00
IGL03030:Olfr1463 APN 19 13235054 missense probably damaging 0.98
IGL03232:Olfr1463 APN 19 13234977 nonsense probably null
IGL03380:Olfr1463 APN 19 13235001 missense probably benign 0.00
PIT4382001:Olfr1463 UTSW 19 13234895 missense probably damaging 1.00
PIT4519001:Olfr1463 UTSW 19 13234852 missense probably benign 0.00
R0652:Olfr1463 UTSW 19 13234535 missense possibly damaging 0.80
R0658:Olfr1463 UTSW 19 13235060 missense possibly damaging 0.94
R1181:Olfr1463 UTSW 19 13234831 missense probably benign 0.07
R1316:Olfr1463 UTSW 19 13234439 missense probably damaging 1.00
R1465:Olfr1463 UTSW 19 13234901 missense possibly damaging 0.61
R1465:Olfr1463 UTSW 19 13234901 missense possibly damaging 0.61
R1900:Olfr1463 UTSW 19 13234913 missense possibly damaging 0.54
R1927:Olfr1463 UTSW 19 13235029 missense probably damaging 1.00
R2239:Olfr1463 UTSW 19 13234721 missense probably benign 0.00
R2380:Olfr1463 UTSW 19 13234721 missense probably benign 0.00
R3760:Olfr1463 UTSW 19 13234886 missense probably damaging 1.00
R3765:Olfr1463 UTSW 19 13234431 missense probably damaging 1.00
R3835:Olfr1463 UTSW 19 13234739 missense probably benign 0.18
R4690:Olfr1463 UTSW 19 13234768 missense possibly damaging 0.91
R4907:Olfr1463 UTSW 19 13234793 missense probably damaging 1.00
R5444:Olfr1463 UTSW 19 13234958 missense probably benign 0.28
R5465:Olfr1463 UTSW 19 13234688 missense probably benign 0.00
R6083:Olfr1463 UTSW 19 13234525 missense probably benign 0.01
R6259:Olfr1463 UTSW 19 13234421 missense probably damaging 0.98
R6324:Olfr1463 UTSW 19 13235104 missense possibly damaging 0.95
R6561:Olfr1463 UTSW 19 13235030 missense probably damaging 1.00
R6845:Olfr1463 UTSW 19 13234633 missense probably damaging 1.00
R7260:Olfr1463 UTSW 19 13235024 missense probably damaging 0.98
X0063:Olfr1463 UTSW 19 13234635 missense probably damaging 1.00
X0067:Olfr1463 UTSW 19 13234697 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GCTGGGACTTACTGATGATCCAGGAC -3'
(R):5'- GCTCATTGATATGCCTATCCGAGCAAG -3'

Sequencing Primer
(F):5'- ACATTTTCACCCTGGTAGGGAAC -3'
(R):5'- CTATCCGAGCAAGAGAGAGCC -3'
Posted On2014-01-29