Incidental Mutation 'R1306:Slc19a3'
ID157792
Institutional Source Beutler Lab
Gene Symbol Slc19a3
Ensembl Gene ENSMUSG00000038496
Gene Namesolute carrier family 19, member 3
SynonymsThTr2, A230084E24Rik
MMRRC Submission 039372-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.188) question?
Stock #R1306 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location83012523-83038448 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 83022762 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 178 (L178S)
Ref Sequence ENSEMBL: ENSMUSP00000126646 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045560] [ENSMUST00000164473]
Predicted Effect probably damaging
Transcript: ENSMUST00000045560
AA Change: L178S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041683
Gene: ENSMUSG00000038496
AA Change: L178S

DomainStartEndE-ValueType
Pfam:Folate_carrier 11 435 1.4e-178 PFAM
Pfam:MFS_1 16 416 1.6e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142805
Predicted Effect probably damaging
Transcript: ENSMUST00000164473
AA Change: L178S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126646
Gene: ENSMUSG00000038496
AA Change: L178S

DomainStartEndE-ValueType
Pfam:Folate_carrier 11 435 1.3e-178 PFAM
Pfam:MFS_1 16 416 1.9e-17 PFAM
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 89.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitously expressed transmembrane thiamine transporter that lacks folate transport activity. Mutations in this gene cause biotin-responsive basal ganglia disease (BBGD); a recessive disorder manifested in childhood that progresses to chronic encephalopathy, dystonia, quadriparesis, and death if untreated. Patients with BBGD have bilateral necrosis in the head of the caudate nucleus and in the putamen. Administration of high doses of biotin in the early progression of the disorder eliminates pathological symptoms while delayed treatment results in residual paraparesis, mild mental retardation, or dystonia. Administration of thiamine is ineffective in the treatment of this disorder. Experiments have failed to show that this protein can transport biotin. Mutations in this gene also cause a Wernicke's-like encephalopathy.[provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit premature death within a year of age, impaired thiamin uptake, lethargy, cachexia, injured liver parenchyma, hepatic necrosis, liver and kidney inflammmation, and nephrosclerosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk3 T A 7: 81,093,873 L1146H probably damaging Het
Atad2b A G 12: 4,974,239 I121M probably benign Het
Atg2a A T 19: 6,253,021 T1053S probably benign Het
Bend5 C T 4: 111,459,773 Q127* probably null Het
Ccser1 G A 6: 62,380,106 D843N probably damaging Het
Dennd4b A G 3: 90,271,165 T512A probably benign Het
Dnmbp A T 19: 43,901,779 D516E probably benign Het
Dok3 C A 13: 55,527,448 E86* probably null Het
Fat3 A G 9: 16,376,679 I516T probably damaging Het
Gabbr1 T A 17: 37,055,990 probably null Het
Gjd2 T C 2: 114,011,865 T44A probably damaging Het
Mcm7 C A 5: 138,167,203 A480S probably damaging Het
Meox2 GCACCACCACCACCACCACCA GCACCACCACCACCACCA 12: 37,109,031 probably benign Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Pdzph1 T C 17: 58,932,432 H967R possibly damaging Het
Pik3c2g A G 6: 139,772,428 N227S probably benign Het
Pkd1 T C 17: 24,573,172 S1278P probably damaging Het
Plch2 T C 4: 155,007,140 E71G probably damaging Het
Pnmal1 A G 7: 16,962,025 R428G probably benign Het
Sertad2 T C 11: 20,648,388 S195P probably benign Het
Smarca2 A G 19: 26,770,988 D139G possibly damaging Het
Tm4sf19 G A 16: 32,407,902 V170M probably damaging Het
Vwa3a C G 7: 120,800,390 S1031R possibly damaging Het
Other mutations in Slc19a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03066:Slc19a3 APN 1 83014836 missense probably damaging 0.99
R0437:Slc19a3 UTSW 1 83022565 missense probably benign 0.00
R0526:Slc19a3 UTSW 1 83022733 missense probably damaging 1.00
R1160:Slc19a3 UTSW 1 83022692 missense possibly damaging 0.85
R1832:Slc19a3 UTSW 1 83022747 missense probably damaging 0.99
R1938:Slc19a3 UTSW 1 83019368 missense possibly damaging 0.76
R1961:Slc19a3 UTSW 1 83022798 missense probably benign 0.00
R2058:Slc19a3 UTSW 1 83014791 missense probably damaging 0.98
R2200:Slc19a3 UTSW 1 83022943 missense probably damaging 0.96
R2245:Slc19a3 UTSW 1 83013970 missense possibly damaging 0.84
R2261:Slc19a3 UTSW 1 83022957 missense probably damaging 1.00
R2404:Slc19a3 UTSW 1 83023035 missense probably benign 0.16
R3891:Slc19a3 UTSW 1 83022957 missense probably damaging 1.00
R3892:Slc19a3 UTSW 1 83022957 missense probably damaging 1.00
R3907:Slc19a3 UTSW 1 83014813 missense possibly damaging 0.76
R3912:Slc19a3 UTSW 1 83022703 missense probably benign 0.09
R3922:Slc19a3 UTSW 1 83022957 missense probably damaging 1.00
R3923:Slc19a3 UTSW 1 83022957 missense probably damaging 1.00
R3961:Slc19a3 UTSW 1 83022957 missense probably damaging 1.00
R4083:Slc19a3 UTSW 1 83022957 missense probably damaging 1.00
R4106:Slc19a3 UTSW 1 83022957 missense probably damaging 1.00
R4107:Slc19a3 UTSW 1 83022957 missense probably damaging 1.00
R4109:Slc19a3 UTSW 1 83022957 missense probably damaging 1.00
R4667:Slc19a3 UTSW 1 83022799 missense probably benign
R4768:Slc19a3 UTSW 1 83023113 missense probably damaging 1.00
R4769:Slc19a3 UTSW 1 83019341 missense probably damaging 1.00
R5001:Slc19a3 UTSW 1 83022620 missense probably benign 0.33
R5538:Slc19a3 UTSW 1 83022561 missense possibly damaging 0.51
R5588:Slc19a3 UTSW 1 83023055 nonsense probably null
R6143:Slc19a3 UTSW 1 83026339 missense probably benign 0.00
R6546:Slc19a3 UTSW 1 83026360 missense probably benign 0.02
R6547:Slc19a3 UTSW 1 83022900 missense probably damaging 1.00
R7059:Slc19a3 UTSW 1 83022369 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCCTTCAGATCCTGGAACCAATGC -3'
(R):5'- GCCACAGAGATAGCCTACTTTGCC -3'

Sequencing Primer
(F):5'- CGCAAAGTGTCTCAAAGCTG -3'
(R):5'- TGCCTACATATACAGCATGGTCAG -3'
Posted On2014-02-18