Incidental Mutation 'R1422:Robo2'
ID161146
Institutional Source Beutler Lab
Gene Symbol Robo2
Ensembl Gene ENSMUSG00000052516
Gene Nameroundabout guidance receptor 2
Synonyms9430089E08Rik, 2600013A04Rik, D230004I22Rik
MMRRC Submission 039478-MU
Accession Numbers

Ncbi RefSeq: NM_175549.4; MGI:1890110

Is this an essential gene? Probably essential (E-score: 0.871) question?
Stock #R1422 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location73891839-74411825 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 73978448 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 466 (T466M)
Ref Sequence ENSEMBL: ENSMUSP00000113795 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117200] [ENSMUST00000117785] [ENSMUST00000226478] [ENSMUST00000227347]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000102329
Predicted Effect probably damaging
Transcript: ENSMUST00000116586
AA Change: T470M

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112285
Gene: ENSMUSG00000052516
AA Change: T470M

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGc2 43 117 3.56e-9 SMART
IGc2 145 210 3.33e-9 SMART
IGc2 237 300 6.59e-13 SMART
IGc2 330 402 1.3e-11 SMART
IGc2 434 499 3.73e-12 SMART
FN3 526 608 1.42e-15 SMART
FN3 640 725 3.54e-2 SMART
FN3 740 827 6.15e-11 SMART
transmembrane domain 864 886 N/A INTRINSIC
low complexity region 1044 1069 N/A INTRINSIC
low complexity region 1076 1087 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117200
AA Change: T466M

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113795
Gene: ENSMUSG00000052516
AA Change: T466M

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGc2 43 117 3.56e-9 SMART
IGc2 145 210 3.33e-9 SMART
IGc2 237 300 6.59e-13 SMART
IGc2 326 398 1.3e-11 SMART
IGc2 430 495 3.73e-12 SMART
FN3 522 604 1.42e-15 SMART
FN3 636 721 3.54e-2 SMART
FN3 736 823 6.15e-11 SMART
transmembrane domain 860 882 N/A INTRINSIC
low complexity region 1040 1065 N/A INTRINSIC
low complexity region 1072 1083 N/A INTRINSIC
low complexity region 1191 1199 N/A INTRINSIC
low complexity region 1210 1234 N/A INTRINSIC
low complexity region 1318 1342 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117785
AA Change: T466M

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112776
Gene: ENSMUSG00000052516
AA Change: T466M

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGc2 43 117 3.56e-9 SMART
IGc2 145 210 3.33e-9 SMART
IGc2 237 300 6.59e-13 SMART
IGc2 326 398 1.3e-11 SMART
IGc2 430 495 3.73e-12 SMART
FN3 522 604 1.42e-15 SMART
FN3 636 721 3.54e-2 SMART
FN3 736 823 6.15e-11 SMART
transmembrane domain 860 882 N/A INTRINSIC
low complexity region 1072 1107 N/A INTRINSIC
low complexity region 1114 1125 N/A INTRINSIC
low complexity region 1233 1241 N/A INTRINSIC
low complexity region 1252 1276 N/A INTRINSIC
low complexity region 1351 1362 N/A INTRINSIC
low complexity region 1451 1475 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147408
Predicted Effect probably damaging
Transcript: ENSMUST00000226478
AA Change: T470M

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect possibly damaging
Transcript: ENSMUST00000227347
AA Change: T470M

PolyPhen 2 Score 0.549 (Sensitivity: 0.88; Specificity: 0.91)
Meta Mutation Damage Score 0.0328 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 89.6%
Validation Efficiency 100% (51/51)
MGI Phenotype Strain: 3759448; 3043127
Lethality: D1
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the ROBO family, part of the immunoglobulin superfamily of proteins that are highly conserved from fly to human. The encoded protein is a transmembrane receptor for the slit homolog 2 protein and functions in axon guidance and cell migration. Mutations in this gene are associated with vesicoureteral reflux, characterized by the backward flow of urine from the bladder into the ureters or the kidney. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous mutants display postnatal lethality, abnormal ureteric bud development, multiple fused kidneys, multiple ureters, and abnormal commissural axon growth. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted(3) Gene trapped(3)

Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik A G 18: 24,477,276 T170A probably benign Het
3110002H16Rik G A 18: 12,181,623 D87N probably damaging Het
4931408C20Rik C G 1: 26,682,466 S1211T possibly damaging Het
Arhgap5 T A 12: 52,519,514 D1089E probably damaging Het
Atrn T C 2: 130,957,914 Y404H probably damaging Het
Becn1 T C 11: 101,295,126 D98G possibly damaging Het
Coro2b A G 9: 62,428,947 probably null Het
Cpne4 T C 9: 104,900,285 I143T probably damaging Het
Cr2 A G 1: 195,171,125 I35T probably benign Het
Ctns T C 11: 73,185,246 Y321C probably damaging Het
Cyp4f16 A T 17: 32,542,999 M174L probably damaging Het
Dpy19l4 T C 4: 11,317,168 E10G possibly damaging Het
Dtx3 T A 10: 127,191,289 I339F possibly damaging Het
Fam184a A T 10: 53,675,208 M625K probably benign Het
Fgd6 A G 10: 94,045,372 E696G probably damaging Het
Gm14685 G T X: 73,127,655 G218C probably damaging Het
Gm17535 A G 9: 3,035,804 Y224C probably null Het
Gria1 T A 11: 57,189,788 L199Q probably benign Het
Hk1 T C 10: 62,296,094 D184G probably null Het
Ift88 T C 14: 57,438,301 probably benign Het
Ift88 G A 14: 57,472,979 V403M probably damaging Het
Igsf1 C A X: 49,782,936 G737* probably null Het
Kif19a A G 11: 114,785,809 D488G probably benign Het
Lpcat2 T C 8: 92,879,417 L232P probably damaging Het
Ly9 A G 1: 171,601,212 V280A probably damaging Het
Macrod2 T A 2: 140,419,941 probably null Het
Mmp1a A G 9: 7,464,298 probably null Het
Mmrn2 A G 14: 34,396,239 H80R probably damaging Het
Olfr1156 G A 2: 87,950,095 T46I probably benign Het
Olfr124 T C 17: 37,805,363 Y73H probably damaging Het
Olfr564 G A 7: 102,803,850 R124H probably benign Het
Pkd1l3 C A 8: 109,621,708 P194H unknown Het
Plk2 A G 13: 110,399,489 M576V probably damaging Het
Pms2 T A 5: 143,913,705 S113T probably damaging Het
Ptprk A G 10: 28,475,280 I590V possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rad17 A G 13: 100,645,082 L69P probably benign Het
Sema6a A G 18: 47,306,431 C9R probably benign Het
Slc6a19 A G 13: 73,685,869 S357P probably benign Het
Spock3 T C 8: 63,143,989 I109T possibly damaging Het
Svs6 T C 2: 164,317,660 probably null Het
Tenm4 A T 7: 96,550,051 D17V probably damaging Het
Trp53bp2 T A 1: 182,446,464 M558K probably benign Het
Ttn T C 2: 76,741,670 E26293G probably damaging Het
Vmn1r29 A G 6: 58,307,886 Y197C probably damaging Het
Wdfy3 A T 5: 101,884,214 probably benign Het
Zfp366 A G 13: 99,229,296 K322E probably damaging Het
Other mutations in Robo2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00666:Robo2 APN 16 73961700 missense probably benign
IGL00849:Robo2 APN 16 73973777 missense possibly damaging 0.80
IGL00908:Robo2 APN 16 73985691 missense probably damaging 0.98
IGL00944:Robo2 APN 16 73933697 missense possibly damaging 0.92
IGL00955:Robo2 APN 16 74015972 missense probably damaging 1.00
IGL00970:Robo2 APN 16 73897046 missense probably benign 0.00
IGL01020:Robo2 APN 16 73928151 missense probably benign 0.06
IGL01347:Robo2 APN 16 74352856 missense probably damaging 1.00
IGL02280:Robo2 APN 16 74046816 missense probably damaging 1.00
IGL02424:Robo2 APN 16 73973301 missense possibly damaging 0.89
IGL03376:Robo2 APN 16 73956492 missense probably damaging 1.00
LCD18:Robo2 UTSW 16 74055954 intron probably benign
P0018:Robo2 UTSW 16 74046806 missense possibly damaging 0.82
R0314:Robo2 UTSW 16 73956637 missense probably damaging 1.00
R0324:Robo2 UTSW 16 73967851 missense probably damaging 1.00
R0539:Robo2 UTSW 16 73985574 splice site probably benign
R0620:Robo2 UTSW 16 73967802 missense possibly damaging 0.92
R0630:Robo2 UTSW 16 73916205 missense probably benign 0.05
R0701:Robo2 UTSW 16 74046874 missense probably damaging 1.00
R1155:Robo2 UTSW 16 74035108 missense probably damaging 1.00
R1168:Robo2 UTSW 16 73948296 missense probably damaging 1.00
R1195:Robo2 UTSW 16 73916128 unclassified probably null
R1195:Robo2 UTSW 16 73916128 unclassified probably null
R1195:Robo2 UTSW 16 73916128 unclassified probably null
R1317:Robo2 UTSW 16 74035024 missense probably damaging 1.00
R1452:Robo2 UTSW 16 73961910 missense probably damaging 1.00
R1649:Robo2 UTSW 16 73899001 missense probably benign 0.36
R1709:Robo2 UTSW 16 73956523 missense possibly damaging 0.83
R1751:Robo2 UTSW 16 74035024 missense probably damaging 1.00
R1761:Robo2 UTSW 16 74035024 missense probably damaging 1.00
R1885:Robo2 UTSW 16 73916145 missense probably benign 0.00
R1911:Robo2 UTSW 16 73958325 missense probably damaging 1.00
R1919:Robo2 UTSW 16 73899154 missense probably benign
R2005:Robo2 UTSW 16 73933115 missense possibly damaging 0.82
R2851:Robo2 UTSW 16 73961888 missense probably damaging 1.00
R3732:Robo2 UTSW 16 73920747 missense possibly damaging 0.64
R3732:Robo2 UTSW 16 73920747 missense possibly damaging 0.64
R3733:Robo2 UTSW 16 73920747 missense possibly damaging 0.64
R3734:Robo2 UTSW 16 73920747 missense possibly damaging 0.64
R3913:Robo2 UTSW 16 74035005 missense probably damaging 1.00
R3956:Robo2 UTSW 16 73961867 missense probably damaging 1.00
R4394:Robo2 UTSW 16 73948379 missense probably benign 0.13
R4426:Robo2 UTSW 16 73948266 missense probably damaging 1.00
R4437:Robo2 UTSW 16 73973244 missense possibly damaging 0.88
R4454:Robo2 UTSW 16 74352519 intron probably benign
R4478:Robo2 UTSW 16 74015873 missense probably damaging 1.00
R4586:Robo2 UTSW 16 73961873 missense probably damaging 0.96
R4621:Robo2 UTSW 16 73985933 missense probably benign 0.00
R4673:Robo2 UTSW 16 73904378 splice site probably null
R4798:Robo2 UTSW 16 74352745 missense probably damaging 1.00
R4812:Robo2 UTSW 16 73916288 missense probably benign 0.00
R4855:Robo2 UTSW 16 73971191 missense probably damaging 1.00
R4910:Robo2 UTSW 16 73933778 missense probably damaging 0.99
R4916:Robo2 UTSW 16 73898915 missense possibly damaging 0.53
R4948:Robo2 UTSW 16 74352838 missense possibly damaging 0.88
R5325:Robo2 UTSW 16 73973785 missense possibly damaging 0.72
R5326:Robo2 UTSW 16 73898965 missense probably benign 0.20
R5447:Robo2 UTSW 16 73973766 nonsense probably null
R5542:Robo2 UTSW 16 73898965 missense probably benign 0.20
R5545:Robo2 UTSW 16 73961747 missense probably damaging 1.00
R5646:Robo2 UTSW 16 73961819 missense probably damaging 0.99
R5734:Robo2 UTSW 16 74352784 missense probably damaging 1.00
R5892:Robo2 UTSW 16 73895780 utr 3 prime probably benign
R5960:Robo2 UTSW 16 73933715 missense probably damaging 1.00
R6126:Robo2 UTSW 16 73920682 missense probably benign 0.00
R6130:Robo2 UTSW 16 73920682 missense probably benign 0.00
R6153:Robo2 UTSW 16 73920729 missense probably damaging 1.00
R6240:Robo2 UTSW 16 73982139 missense probably damaging 1.00
R6247:Robo2 UTSW 16 73967784 missense probably damaging 1.00
R6304:Robo2 UTSW 16 73958308 missense probably damaging 1.00
R6337:Robo2 UTSW 16 73928151 missense probably benign 0.06
R6431:Robo2 UTSW 16 74046809 nonsense probably null
R6440:Robo2 UTSW 16 73916122 missense probably benign 0.31
R6596:Robo2 UTSW 16 73971108 missense probably damaging 1.00
R6919:Robo2 UTSW 16 73961867 missense probably damaging 1.00
R6927:Robo2 UTSW 16 73982058 missense probably damaging 1.00
R7029:Robo2 UTSW 16 73948337 missense probably damaging 1.00
R7078:Robo2 UTSW 16 74352616 missense not run
R7092:Robo2 UTSW 16 73956643 missense not run
R7136:Robo2 UTSW 16 73956550 missense not run
X0063:Robo2 UTSW 16 74045828 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAATACCAGAGTTGGATTCCCAAGACC -3'
(R):5'- TTTATGACTGGCAGCTCGTAGAAGC -3'

Sequencing Primer
(F):5'- GAGTTGGATTCCCAAGACCAAATTAC -3'
(R):5'- CAATGATATGTTCTGAGTGCAGC -3'
Posted On2014-03-14