Incidental Mutation 'R1454:Tbc1d32'
ID162211
Institutional Source Beutler Lab
Gene Symbol Tbc1d32
Ensembl Gene ENSMUSG00000038122
Gene NameTBC1 domain family, member 32
SynonymsD630037F22Rik, C6orf170, Bromi, b2b2284Clo
MMRRC Submission 039509-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.837) question?
Stock #R1454 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location56014293-56228689 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 56177479 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000097328 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099739]
Predicted Effect probably benign
Transcript: ENSMUST00000099739
SMART Domains Protein: ENSMUSP00000097328
Gene: ENSMUSG00000038122

DomainStartEndE-ValueType
Pfam:BROMI 12 1293 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219385
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 89.2%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a TBC-domain containing protein. Studies of a similar protein in mouse and zebrafish suggest that the encoded protein is involved in sonic hedgehog signaling, and that it interacts with and stabilizes cell cycle-related kinase. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a gene trap allele or ENU induced mutation exhibit exencephaly and poor eye development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts5 A G 16: 85,869,993 V537A possibly damaging Het
Adcy10 A T 1: 165,515,380 I272F possibly damaging Het
Adcy6 A G 15: 98,604,728 S2P probably damaging Het
Agap1 A G 1: 89,837,806 probably null Het
Aldh3a2 A G 11: 61,265,102 V116A probably benign Het
Ankdd1b A T 13: 96,433,405 probably null Het
Antxrl G A 14: 34,060,949 V233I probably damaging Het
Atp8b5 A G 4: 43,302,590 I38V probably benign Het
Atxn7l2 A G 3: 108,208,432 probably benign Het
Bfsp2 A T 9: 103,480,225 M1K probably null Het
Camsap3 T A 8: 3,603,968 I520N possibly damaging Het
Cenpc1 C T 5: 86,013,510 V854I possibly damaging Het
Csnk2a1 T C 2: 152,257,427 L88S probably damaging Het
Dcaf17 A G 2: 71,073,173 N171D probably damaging Het
Dctn1 G C 6: 83,197,508 A1077P possibly damaging Het
Dock1 T C 7: 134,851,609 probably benign Het
Egfr A T 11: 16,889,920 I645L probably benign Het
Gdpd1 T G 11: 87,059,509 K79N possibly damaging Het
Ggt5 A T 10: 75,609,908 L432F probably benign Het
Gm11060 A G 2: 105,093,752 T22A unknown Het
Gpr132 G A 12: 112,852,240 T322I possibly damaging Het
Grin1 G A 2: 25,292,430 R940* probably null Het
Hip1 T C 5: 135,438,632 T316A probably benign Het
Hnrnpm A G 17: 33,666,488 probably benign Het
Hsd3b5 G A 3: 98,619,530 T200I probably benign Het
Hspa9 A T 18: 34,938,606 L647H probably damaging Het
Itgad T C 7: 128,192,137 I727T probably benign Het
Kcnma1 T C 14: 23,463,200 D522G probably damaging Het
Lipf C T 19: 33,970,732 probably benign Het
Ly6i T C 15: 74,983,055 D2G possibly damaging Het
Mast1 G A 8: 84,920,635 P631L probably damaging Het
Mmp1b G C 9: 7,386,693 L144V probably damaging Het
Msh6 A G 17: 87,984,758 S314G probably benign Het
Myo5c G A 9: 75,263,066 V493I possibly damaging Het
Nefm A G 14: 68,121,379 L402P probably damaging Het
Nrxn2 T C 19: 6,481,446 F697S probably damaging Het
Olfr156 A T 4: 43,820,639 C241S probably damaging Het
Pex13 A G 11: 23,649,422 I363T probably benign Het
Plcb3 T C 19: 6,955,046 R1082G possibly damaging Het
Psg28 A T 7: 18,427,964 S205T possibly damaging Het
Pxt1 C A 17: 28,934,782 V26L possibly damaging Het
Ripk2 G A 4: 16,163,239 T53M probably damaging Het
Slc5a9 A G 4: 111,883,964 V495A probably benign Het
Snrpa T C 7: 27,192,937 K66R probably benign Het
Srgap1 T A 10: 121,896,738 E145V probably damaging Het
Suz12 A G 11: 80,032,113 T694A probably benign Het
Tatdn2 T A 6: 113,704,327 D440E probably benign Het
Tbc1d21 A G 9: 58,362,813 probably null Het
Tbc1d31 T A 15: 57,951,638 Y570* probably null Het
Tdrd5 G C 1: 156,259,836 Q839E probably benign Het
Tecpr2 A G 12: 110,968,953 N1402S probably benign Het
Thbs1 A G 2: 118,122,672 D921G probably damaging Het
Tll1 A G 8: 64,038,490 V803A probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trpm4 T C 7: 45,317,056 E461G probably damaging Het
Zp3 T A 5: 135,984,188 I152N probably damaging Het
Other mutations in Tbc1d32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Tbc1d32 APN 10 56155765 missense probably damaging 1.00
IGL00535:Tbc1d32 APN 10 56215125 splice site probably benign
IGL00835:Tbc1d32 APN 10 56089846 splice site probably benign
IGL01013:Tbc1d32 APN 10 56201959 splice site probably null
IGL01306:Tbc1d32 APN 10 56180524 missense probably benign 0.14
IGL01452:Tbc1d32 APN 10 56215080 missense possibly damaging 0.71
IGL01668:Tbc1d32 APN 10 56123577 missense probably benign 0.37
IGL02008:Tbc1d32 APN 10 56151775 missense possibly damaging 0.71
IGL02076:Tbc1d32 APN 10 56088403 missense possibly damaging 0.93
IGL02348:Tbc1d32 APN 10 56224619 missense probably benign 0.06
IGL02476:Tbc1d32 APN 10 56198542 missense possibly damaging 0.71
IGL02750:Tbc1d32 APN 10 56198491 missense possibly damaging 0.95
IGL02893:Tbc1d32 APN 10 56017703 missense probably damaging 0.98
ANU23:Tbc1d32 UTSW 10 56180524 missense probably benign 0.14
P0035:Tbc1d32 UTSW 10 56198439 missense probably damaging 1.00
R0118:Tbc1d32 UTSW 10 56017605 missense probably benign 0.02
R0446:Tbc1d32 UTSW 10 56192898 missense possibly damaging 0.93
R0567:Tbc1d32 UTSW 10 56173963 missense possibly damaging 0.71
R0615:Tbc1d32 UTSW 10 56224640 missense probably benign 0.33
R0679:Tbc1d32 UTSW 10 56180576 missense probably damaging 0.99
R0943:Tbc1d32 UTSW 10 56161147 missense probably benign
R1432:Tbc1d32 UTSW 10 56017662 missense probably damaging 0.99
R1708:Tbc1d32 UTSW 10 56151769 missense possibly damaging 0.84
R1834:Tbc1d32 UTSW 10 56017604 missense probably benign 0.00
R1860:Tbc1d32 UTSW 10 56123537 nonsense probably null
R2208:Tbc1d32 UTSW 10 56150792 critical splice donor site probably null
R3012:Tbc1d32 UTSW 10 56173915 missense probably benign 0.08
R3736:Tbc1d32 UTSW 10 56129093 missense probably damaging 0.99
R4184:Tbc1d32 UTSW 10 56224580 missense probably benign 0.15
R4259:Tbc1d32 UTSW 10 56049771 missense probably damaging 0.97
R4617:Tbc1d32 UTSW 10 56170904 missense possibly damaging 0.92
R4700:Tbc1d32 UTSW 10 56224649 missense probably damaging 0.98
R4794:Tbc1d32 UTSW 10 56196836 missense possibly damaging 0.92
R4879:Tbc1d32 UTSW 10 56049029 splice site probably null
R5031:Tbc1d32 UTSW 10 56123531 missense probably damaging 0.98
R5036:Tbc1d32 UTSW 10 56195404 nonsense probably null
R5276:Tbc1d32 UTSW 10 56151818 missense probably damaging 0.99
R5358:Tbc1d32 UTSW 10 56170937 missense possibly damaging 0.93
R5429:Tbc1d32 UTSW 10 56027993 missense probably damaging 0.99
R5435:Tbc1d32 UTSW 10 56040150 missense probably damaging 0.98
R5451:Tbc1d32 UTSW 10 56195475 missense possibly damaging 0.95
R5607:Tbc1d32 UTSW 10 56129150 missense possibly damaging 0.92
R5642:Tbc1d32 UTSW 10 56150877 missense possibly damaging 0.82
R5732:Tbc1d32 UTSW 10 56088393 missense probably damaging 0.99
R5795:Tbc1d32 UTSW 10 56215062 missense possibly damaging 0.71
R5988:Tbc1d32 UTSW 10 56088337 missense probably damaging 0.98
R6054:Tbc1d32 UTSW 10 56162208 missense possibly damaging 0.95
R6103:Tbc1d32 UTSW 10 56150883 missense probably damaging 0.99
R6277:Tbc1d32 UTSW 10 56195429 missense probably benign
R6422:Tbc1d32 UTSW 10 56028061 nonsense probably null
R6508:Tbc1d32 UTSW 10 56224690 missense probably damaging 0.98
R6859:Tbc1d32 UTSW 10 56180530 missense probably damaging 0.98
R6887:Tbc1d32 UTSW 10 56151811 nonsense probably null
R7012:Tbc1d32 UTSW 10 56224724 missense probably damaging 0.99
R7253:Tbc1d32 UTSW 10 56198441 missense probably benign
R7288:Tbc1d32 UTSW 10 56051387 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACGCAGAGTCTTAAACCCGTTTACC -3'
(R):5'- TGGCAGAACTGTGCCTGAACATATC -3'

Sequencing Primer
(F):5'- AGTCTTAAACCCGTTTACCAAAATAG -3'
(R):5'- GGATGTTAGCTGCCCATCAAC -3'
Posted On2014-03-14