Incidental Mutation 'R1454:Gdpd1'
ID162218
Institutional Source Beutler Lab
Gene Symbol Gdpd1
Ensembl Gene ENSMUSG00000061666
Gene Nameglycerophosphodiester phosphodiesterase domain containing 1
Synonyms
MMRRC Submission 039509-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R1454 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location87033867-87074062 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 87059509 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 79 (K79N)
Ref Sequence ENSEMBL: ENSMUSP00000020804 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020804]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020804
AA Change: K79N

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000020804
Gene: ENSMUSG00000061666
AA Change: K79N

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
Pfam:GDPD 45 204 1.2e-26 PFAM
low complexity region 206 217 N/A INTRINSIC
Meta Mutation Damage Score 0.36 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 89.2%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the glycerophosphodiester phosphodiesterase family of enzymes that catalyze the hydrolysis of deacylated glycerophospholipids to glycerol phosphate and alcohol. The encoded protein is localized to the cytoplasm and concentrates near the perinuclear region. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts5 A G 16: 85,869,993 V537A possibly damaging Het
Adcy10 A T 1: 165,515,380 I272F possibly damaging Het
Adcy6 A G 15: 98,604,728 S2P probably damaging Het
Agap1 A G 1: 89,837,806 probably null Het
Aldh3a2 A G 11: 61,265,102 V116A probably benign Het
Ankdd1b A T 13: 96,433,405 probably null Het
Antxrl G A 14: 34,060,949 V233I probably damaging Het
Atp8b5 A G 4: 43,302,590 I38V probably benign Het
Atxn7l2 A G 3: 108,208,432 probably benign Het
Bfsp2 A T 9: 103,480,225 M1K probably null Het
Camsap3 T A 8: 3,603,968 I520N possibly damaging Het
Cenpc1 C T 5: 86,013,510 V854I possibly damaging Het
Csnk2a1 T C 2: 152,257,427 L88S probably damaging Het
Dcaf17 A G 2: 71,073,173 N171D probably damaging Het
Dctn1 G C 6: 83,197,508 A1077P possibly damaging Het
Dock1 T C 7: 134,851,609 probably benign Het
Egfr A T 11: 16,889,920 I645L probably benign Het
Ggt5 A T 10: 75,609,908 L432F probably benign Het
Gm11060 A G 2: 105,093,752 T22A unknown Het
Gpr132 G A 12: 112,852,240 T322I possibly damaging Het
Grin1 G A 2: 25,292,430 R940* probably null Het
Hip1 T C 5: 135,438,632 T316A probably benign Het
Hnrnpm A G 17: 33,666,488 probably benign Het
Hsd3b5 G A 3: 98,619,530 T200I probably benign Het
Hspa9 A T 18: 34,938,606 L647H probably damaging Het
Itgad T C 7: 128,192,137 I727T probably benign Het
Kcnma1 T C 14: 23,463,200 D522G probably damaging Het
Lipf C T 19: 33,970,732 probably benign Het
Ly6i T C 15: 74,983,055 D2G possibly damaging Het
Mast1 G A 8: 84,920,635 P631L probably damaging Het
Mmp1b G C 9: 7,386,693 L144V probably damaging Het
Msh6 A G 17: 87,984,758 S314G probably benign Het
Myo5c G A 9: 75,263,066 V493I possibly damaging Het
Nefm A G 14: 68,121,379 L402P probably damaging Het
Nrxn2 T C 19: 6,481,446 F697S probably damaging Het
Olfr156 A T 4: 43,820,639 C241S probably damaging Het
Pex13 A G 11: 23,649,422 I363T probably benign Het
Plcb3 T C 19: 6,955,046 R1082G possibly damaging Het
Psg28 A T 7: 18,427,964 S205T possibly damaging Het
Pxt1 C A 17: 28,934,782 V26L possibly damaging Het
Ripk2 G A 4: 16,163,239 T53M probably damaging Het
Slc5a9 A G 4: 111,883,964 V495A probably benign Het
Snrpa T C 7: 27,192,937 K66R probably benign Het
Srgap1 T A 10: 121,896,738 E145V probably damaging Het
Suz12 A G 11: 80,032,113 T694A probably benign Het
Tatdn2 T A 6: 113,704,327 D440E probably benign Het
Tbc1d21 A G 9: 58,362,813 probably null Het
Tbc1d31 T A 15: 57,951,638 Y570* probably null Het
Tbc1d32 A T 10: 56,177,479 probably benign Het
Tdrd5 G C 1: 156,259,836 Q839E probably benign Het
Tecpr2 A G 12: 110,968,953 N1402S probably benign Het
Thbs1 A G 2: 118,122,672 D921G probably damaging Het
Tll1 A G 8: 64,038,490 V803A probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trpm4 T C 7: 45,317,056 E461G probably damaging Het
Zp3 T A 5: 135,984,188 I152N probably damaging Het
Other mutations in Gdpd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02279:Gdpd1 APN 11 87073901 missense probably benign 0.00
IGL02585:Gdpd1 APN 11 87073976 start codon destroyed probably null 0.98
PIT4687001:Gdpd1 UTSW 11 87059540 missense probably damaging 1.00
R0947:Gdpd1 UTSW 11 87037881 missense probably benign
R2086:Gdpd1 UTSW 11 87035268 missense probably benign
R2183:Gdpd1 UTSW 11 87035276 missense probably damaging 1.00
R4416:Gdpd1 UTSW 11 87035288 missense probably benign 0.44
R5517:Gdpd1 UTSW 11 87059506 missense probably damaging 1.00
R7038:Gdpd1 UTSW 11 87035292 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTTGTTTGAGACAGGAGCCCAGAG -3'
(R):5'- CATAGCTGCCTATGGAAGAGGCAAC -3'

Sequencing Primer
(F):5'- TAAGGCTGTGAGCCATCATC -3'
(R):5'- CCTATGGAAGAGGCAACATGATTC -3'
Posted On2014-03-14