Incidental Mutation 'R1454:Lipf'
ID162237
Institutional Source Beutler Lab
Gene Symbol Lipf
Ensembl Gene ENSMUSG00000024768
Gene Namelipase, gastric
Synonyms
MMRRC Submission 039509-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R1454 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location33961187-33976810 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to T at 33970732 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000025680 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025680]
Predicted Effect probably benign
Transcript: ENSMUST00000025680
SMART Domains Protein: ENSMUSP00000025680
Gene: ENSMUSG00000024768

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Abhydro_lipase 34 96 2.9e-27 PFAM
Pfam:Abhydrolase_1 77 377 2.3e-26 PFAM
Pfam:Abhydrolase_5 78 372 1.5e-9 PFAM
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 89.2%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes gastric lipase, an enzyme involved in the digestion of dietary triglycerides in the gastrointestinal tract, and responsible for 30% of fat digestion processes occurring in human. It is secreted by gastric chief cells in the fundic mucosa of the stomach, and it hydrolyzes the ester bonds of triglycerides under acidic pH conditions. The gene is a member of a conserved gene family of lipases that play distinct roles in neutral lipid metabolism. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts5 A G 16: 85,869,993 V537A possibly damaging Het
Adcy10 A T 1: 165,515,380 I272F possibly damaging Het
Adcy6 A G 15: 98,604,728 S2P probably damaging Het
Agap1 A G 1: 89,837,806 probably null Het
Aldh3a2 A G 11: 61,265,102 V116A probably benign Het
Ankdd1b A T 13: 96,433,405 probably null Het
Antxrl G A 14: 34,060,949 V233I probably damaging Het
Atp8b5 A G 4: 43,302,590 I38V probably benign Het
Atxn7l2 A G 3: 108,208,432 probably benign Het
Bfsp2 A T 9: 103,480,225 M1K probably null Het
Camsap3 T A 8: 3,603,968 I520N possibly damaging Het
Cenpc1 C T 5: 86,013,510 V854I possibly damaging Het
Csnk2a1 T C 2: 152,257,427 L88S probably damaging Het
Dcaf17 A G 2: 71,073,173 N171D probably damaging Het
Dctn1 G C 6: 83,197,508 A1077P possibly damaging Het
Dock1 T C 7: 134,851,609 probably benign Het
Egfr A T 11: 16,889,920 I645L probably benign Het
Gdpd1 T G 11: 87,059,509 K79N possibly damaging Het
Ggt5 A T 10: 75,609,908 L432F probably benign Het
Gm11060 A G 2: 105,093,752 T22A unknown Het
Gpr132 G A 12: 112,852,240 T322I possibly damaging Het
Grin1 G A 2: 25,292,430 R940* probably null Het
Hip1 T C 5: 135,438,632 T316A probably benign Het
Hnrnpm A G 17: 33,666,488 probably benign Het
Hsd3b5 G A 3: 98,619,530 T200I probably benign Het
Hspa9 A T 18: 34,938,606 L647H probably damaging Het
Itgad T C 7: 128,192,137 I727T probably benign Het
Kcnma1 T C 14: 23,463,200 D522G probably damaging Het
Ly6i T C 15: 74,983,055 D2G possibly damaging Het
Mast1 G A 8: 84,920,635 P631L probably damaging Het
Mmp1b G C 9: 7,386,693 L144V probably damaging Het
Msh6 A G 17: 87,984,758 S314G probably benign Het
Myo5c G A 9: 75,263,066 V493I possibly damaging Het
Nefm A G 14: 68,121,379 L402P probably damaging Het
Nrxn2 T C 19: 6,481,446 F697S probably damaging Het
Olfr156 A T 4: 43,820,639 C241S probably damaging Het
Pex13 A G 11: 23,649,422 I363T probably benign Het
Plcb3 T C 19: 6,955,046 R1082G possibly damaging Het
Psg28 A T 7: 18,427,964 S205T possibly damaging Het
Pxt1 C A 17: 28,934,782 V26L possibly damaging Het
Ripk2 G A 4: 16,163,239 T53M probably damaging Het
Slc5a9 A G 4: 111,883,964 V495A probably benign Het
Snrpa T C 7: 27,192,937 K66R probably benign Het
Srgap1 T A 10: 121,896,738 E145V probably damaging Het
Suz12 A G 11: 80,032,113 T694A probably benign Het
Tatdn2 T A 6: 113,704,327 D440E probably benign Het
Tbc1d21 A G 9: 58,362,813 probably null Het
Tbc1d31 T A 15: 57,951,638 Y570* probably null Het
Tbc1d32 A T 10: 56,177,479 probably benign Het
Tdrd5 G C 1: 156,259,836 Q839E probably benign Het
Tecpr2 A G 12: 110,968,953 N1402S probably benign Het
Thbs1 A G 2: 118,122,672 D921G probably damaging Het
Tll1 A G 8: 64,038,490 V803A probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trpm4 T C 7: 45,317,056 E461G probably damaging Het
Zp3 T A 5: 135,984,188 I152N probably damaging Het
Other mutations in Lipf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01902:Lipf APN 19 33970779 missense probably benign 0.33
IGL02024:Lipf APN 19 33976595 missense probably damaging 1.00
R1427:Lipf UTSW 19 33965600 missense probably damaging 1.00
R1484:Lipf UTSW 19 33964780 missense probably benign 0.00
R1636:Lipf UTSW 19 33976535 missense probably damaging 1.00
R1720:Lipf UTSW 19 33965666 nonsense probably null
R1916:Lipf UTSW 19 33965675 missense probably benign 0.07
R2010:Lipf UTSW 19 33973546 missense probably benign
R2519:Lipf UTSW 19 33965525 missense probably damaging 0.99
R2937:Lipf UTSW 19 33973038 missense probably damaging 1.00
R4063:Lipf UTSW 19 33965565 missense probably benign 0.43
R4640:Lipf UTSW 19 33968797 missense probably damaging 0.98
R4671:Lipf UTSW 19 33976676 missense possibly damaging 0.94
R4818:Lipf UTSW 19 33965688 missense probably benign 0.04
R5619:Lipf UTSW 19 33966892 missense possibly damaging 0.95
R6034:Lipf UTSW 19 33964889 missense probably benign
R6034:Lipf UTSW 19 33964889 missense probably benign
R6045:Lipf UTSW 19 33966844 missense probably damaging 1.00
R6464:Lipf UTSW 19 33973544 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCTCGTCTAAAGCCATAGACACTGG -3'
(R):5'- TGGGGAAGTCTCATGAATGGAGACC -3'

Sequencing Primer
(F):5'- GGAGGCATTTAGACATTGCATCAC -3'
(R):5'- TCTCATGAATGGAGACCACAATG -3'
Posted On2014-03-14