Incidental Mutation 'R1478:Hmx3'
ID165626
Institutional Source Beutler Lab
Gene Symbol Hmx3
Ensembl Gene ENSMUSG00000040148
Gene NameH6 homeobox 3
SynonymsNkx5.1, Nkx5-1
MMRRC Submission 039531-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.664) question?
Stock #R1478 (G1)
Quality Score90
Status Not validated
Chromosome7
Chromosomal Location131542867-131544925 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 131544097 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 178 (E178G)
Ref Sequence ENSEMBL: ENSMUSP00000039018 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046093] [ENSMUST00000124096] [ENSMUST00000183219]
Predicted Effect probably damaging
Transcript: ENSMUST00000046093
AA Change: E178G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000039018
Gene: ENSMUSG00000040148
AA Change: E178G

DomainStartEndE-ValueType
low complexity region 14 26 N/A INTRINSIC
low complexity region 44 52 N/A INTRINSIC
low complexity region 57 84 N/A INTRINSIC
low complexity region 173 208 N/A INTRINSIC
HOX 227 289 1.78e-23 SMART
low complexity region 315 325 N/A INTRINSIC
low complexity region 337 356 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183219
SMART Domains Protein: ENSMUSP00000138799
Gene: ENSMUSG00000050100

DomainStartEndE-ValueType
low complexity region 46 58 N/A INTRINSIC
low complexity region 90 103 N/A INTRINSIC
HOX 149 211 1.31e-21 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 90.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for targeted null mutations exhibit hyperactivity and circling behavior, and severe vestibular defects. Mutant females are infertile due to failure of implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931417E11Rik A T 6: 73,469,056 L170Q probably damaging Het
Aacs T A 5: 125,503,223 I204N possibly damaging Het
Acaca A G 11: 84,372,627 T2025A probably damaging Het
B4galt3 C T 1: 171,276,365 R170C probably benign Het
BC028528 T C 3: 95,891,959 probably null Het
Ccdc73 A T 2: 104,907,610 Q17L possibly damaging Het
Ccdc73 A G 2: 104,914,667 T50A possibly damaging Het
Ccdc83 T C 7: 90,259,469 D19G probably damaging Het
Cct8l1 T C 5: 25,517,769 V494A probably benign Het
Chd1 T C 17: 15,739,507 F663L probably damaging Het
Chn2 A T 6: 54,293,080 E319V probably damaging Het
Cnnm1 T C 19: 43,471,856 V679A probably damaging Het
Cntn6 C T 6: 104,776,428 T447I probably benign Het
Cyp3a11 G T 5: 145,858,771 L457I probably benign Het
Dera T A 6: 137,830,195 S214T possibly damaging Het
Dmtf1 A G 5: 9,121,404 V501A possibly damaging Het
Dnpep A G 1: 75,316,027 V114A probably damaging Het
Dscam C T 16: 96,790,910 V722M probably benign Het
Dsp A G 13: 38,181,138 N499S probably damaging Het
Ecd A T 14: 20,346,657 Y53* probably null Het
Esyt3 T C 9: 99,318,066 T692A probably benign Het
Fam19a2 T A 10: 123,593,496 M5K possibly damaging Het
Fat1 T A 8: 45,025,622 N2545K probably damaging Het
Fndc3a A G 14: 72,557,632 probably null Het
Fscn3 A G 6: 28,430,568 M246V probably benign Het
Gde1 G T 7: 118,691,784 T106K probably benign Het
Gjc2 A G 11: 59,177,608 I16T possibly damaging Het
Hacd4 A T 4: 88,423,023 M168K probably damaging Het
Htt A G 5: 34,803,827 Y266C probably damaging Het
Kif27 G T 13: 58,303,545 R990S probably damaging Het
Krtap22-2 A T 16: 89,010,646 Y21* probably null Het
Lrrc41 T A 4: 116,095,208 L661* probably null Het
Lrrc63 T C 14: 75,125,984 T236A probably benign Het
Mmp13 T C 9: 7,272,892 L84P probably damaging Het
Myh8 T C 11: 67,292,725 I754T probably benign Het
Neb A C 2: 52,175,607 D5961E probably benign Het
Nlrx1 T C 9: 44,264,077 H134R probably benign Het
Npepps A T 11: 97,226,847 M542K probably benign Het
Nup160 C T 2: 90,679,399 probably benign Het
Olfr402 T A 11: 74,155,137 probably null Het
Olfr952 T A 9: 39,426,592 T160S possibly damaging Het
Pikfyve T C 1: 65,262,977 probably null Het
Ppp6r1 A T 7: 4,640,378 probably null Het
Prss33 A G 17: 23,835,098 W45R probably damaging Het
Ptprf A T 4: 118,212,105 Y980* probably null Het
Qrich1 T C 9: 108,559,332 V743A probably benign Het
Rev3l G A 10: 39,783,333 probably null Het
Samd9l A T 6: 3,376,369 N297K probably benign Het
Sap130 A G 18: 31,680,474 H528R possibly damaging Het
Slc9b2 T C 3: 135,326,102 V241A probably benign Het
Snx14 A T 9: 88,394,528 V577E probably benign Het
Srrm2 T C 17: 23,815,902 S507P probably benign Het
Stat2 A G 10: 128,282,100 probably null Het
Susd5 T C 9: 114,096,684 F545S probably benign Het
Tnnt2 A G 1: 135,848,026 T107A probably benign Het
Trappc6b T A 12: 59,048,167 I41F possibly damaging Het
Ttn T A 2: 76,852,073 probably benign Het
Vmn1r88 A C 7: 13,177,951 D78A probably damaging Het
Wisp3 G A 10: 39,153,243 R230W probably damaging Het
Xpc C T 6: 91,508,528 D122N possibly damaging Het
Xpo1 C T 11: 23,291,623 A890V probably damaging Het
Zfp493 A G 13: 67,786,561 H211R probably damaging Het
Zfp958 A T 8: 4,629,190 H405L probably damaging Het
Other mutations in Hmx3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01962:Hmx3 APN 7 131544271 missense probably damaging 1.00
IGL02731:Hmx3 APN 7 131543963 unclassified probably null
R0924:Hmx3 UTSW 7 131543084 missense probably benign 0.00
R0930:Hmx3 UTSW 7 131543084 missense probably benign 0.00
R0960:Hmx3 UTSW 7 131543314 missense probably benign 0.18
R2126:Hmx3 UTSW 7 131544549 missense possibly damaging 0.86
R4667:Hmx3 UTSW 7 131544382 missense possibly damaging 0.91
R5267:Hmx3 UTSW 7 131544169 missense probably benign 0.15
R5326:Hmx3 UTSW 7 131544417 nonsense probably null
R5386:Hmx3 UTSW 7 131544304 missense probably damaging 1.00
R5779:Hmx3 UTSW 7 131544328 nonsense probably null
R6326:Hmx3 UTSW 7 131543005 intron probably benign
X0050:Hmx3 UTSW 7 131544151 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGGCAGGGTTGAACCTTAGCAGTG -3'
(R):5'- GCGTTTCATGTCGAATGTGGACTCG -3'

Sequencing Primer
(F):5'- TCGCTCAAGGCTGTGTC -3'
(R):5'- TCGAGCTGGAAGACCTGG -3'
Posted On2014-03-28