Incidental Mutation 'R1527:Stat5b'
ID166301
Institutional Source Beutler Lab
Gene Symbol Stat5b
Ensembl Gene ENSMUSG00000020919
Gene Namesignal transducer and activator of transcription 5B
Synonyms
MMRRC Submission 039567-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1527 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location100780731-100850724 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 100808394 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000102981 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004143] [ENSMUST00000004143] [ENSMUST00000004143] [ENSMUST00000107358] [ENSMUST00000107358] [ENSMUST00000107358]
Predicted Effect probably null
Transcript: ENSMUST00000004143
SMART Domains Protein: ENSMUSP00000004143
Gene: ENSMUSG00000020919

DomainStartEndE-ValueType
STAT_int 2 126 2.3e-60 SMART
Pfam:STAT_alpha 138 330 1e-57 PFAM
Pfam:STAT_bind 332 583 1.6e-100 PFAM
SH2 587 676 3.23e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000004143
SMART Domains Protein: ENSMUSP00000004143
Gene: ENSMUSG00000020919

DomainStartEndE-ValueType
STAT_int 2 126 2.3e-60 SMART
Pfam:STAT_alpha 138 330 1e-57 PFAM
Pfam:STAT_bind 332 583 1.6e-100 PFAM
SH2 587 676 3.23e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000004143
SMART Domains Protein: ENSMUSP00000004143
Gene: ENSMUSG00000020919

DomainStartEndE-ValueType
STAT_int 2 126 2.3e-60 SMART
Pfam:STAT_alpha 138 330 1e-57 PFAM
Pfam:STAT_bind 332 583 1.6e-100 PFAM
SH2 587 676 3.23e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000107358
SMART Domains Protein: ENSMUSP00000102981
Gene: ENSMUSG00000020919

DomainStartEndE-ValueType
STAT_int 2 126 2.3e-60 SMART
Pfam:STAT_alpha 141 330 7.1e-56 PFAM
Pfam:STAT_bind 332 582 3.3e-105 PFAM
SH2 587 676 3.23e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000107358
SMART Domains Protein: ENSMUSP00000102981
Gene: ENSMUSG00000020919

DomainStartEndE-ValueType
STAT_int 2 126 2.3e-60 SMART
Pfam:STAT_alpha 141 330 7.1e-56 PFAM
Pfam:STAT_bind 332 582 3.3e-105 PFAM
SH2 587 676 3.23e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000107358
SMART Domains Protein: ENSMUSP00000102981
Gene: ENSMUSG00000020919

DomainStartEndE-ValueType
STAT_int 2 126 2.3e-60 SMART
Pfam:STAT_alpha 141 330 7.1e-56 PFAM
Pfam:STAT_bind 332 582 3.3e-105 PFAM
SH2 587 676 3.23e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126266
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the STAT family of transcription factors. In response to cytokines and growth factors, STAT family members are phosphorylated by the receptor associated kinases, and then form homo- or heterodimers that translocate to the cell nucleus where they act as transcription activators. This protein mediates the signal transduction triggered by various cell ligands, such as IL2, IL4, CSF1, and different growth hormones. It has been shown to be involved in diverse biological processes, such as TCR signaling, apoptosis, adult mammary gland development, and sexual dimorphism of liver gene expression. This gene was found to fuse to retinoic acid receptor-alpha (RARA) gene in a small subset of acute promyelocytic leukemias (APLL). The dysregulation of the signaling pathways mediated by this protein may be the cause of the APLL. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this are reduced in size and mammary glands secrete reduced levels of some milk proteins during lactation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059E24Rik C A 19: 21,598,269 C130F probably damaging Het
4933402N03Rik T C 7: 131,138,860 D209G probably benign Het
Adam7 A G 14: 68,501,521 V744A probably benign Het
Atr G T 9: 95,870,043 R571I possibly damaging Het
C5ar1 A G 7: 16,248,193 Y301H probably damaging Het
Cacna1d A G 14: 30,107,796 I954T probably damaging Het
Ccdc157 A G 11: 4,151,795 F42S probably damaging Het
Chd2 A T 7: 73,490,614 L622* probably null Het
Csmd3 T C 15: 47,948,087 T1203A probably benign Het
Cxcl17 A G 7: 25,402,211 V67A possibly damaging Het
Ddx4 T C 13: 112,622,239 T263A possibly damaging Het
Eps8l1 A G 7: 4,471,394 D288G probably benign Het
Fam208a T C 14: 27,480,093 probably null Het
Fbxl4 A G 4: 22,386,154 K254E probably benign Het
Glis1 T C 4: 107,567,926 S245P probably damaging Het
Gm11111 T C 5: 98,553,528 probably benign Het
Haus3 A T 5: 34,154,053 H544Q probably benign Het
Hmcn1 A G 1: 150,773,803 V644A probably benign Het
Lmo7 T C 14: 101,876,828 L2P probably damaging Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Mga A G 2: 119,916,597 T410A probably damaging Het
Mical3 T C 6: 121,024,779 D584G probably damaging Het
Miga1 A T 3: 152,317,663 F250L possibly damaging Het
Mroh1 A G 15: 76,452,263 D1553G probably benign Het
Myof T C 19: 37,924,619 Y1462C probably damaging Het
Notch4 T C 17: 34,565,744 C144R probably damaging Het
Obox1 T C 7: 15,555,325 V55A probably damaging Het
Olfr1241 C T 2: 89,482,532 G201D probably benign Het
Olfr761 T A 17: 37,952,829 H65L possibly damaging Het
Olfr822 T A 10: 130,075,192 S261T probably damaging Het
Pclo T C 5: 14,679,648 probably benign Het
Prr14l C T 5: 32,827,949 V1401I possibly damaging Het
Rad51ap1 T C 6: 126,928,167 probably null Het
Rev3l T A 10: 39,822,822 V1105D probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Sgsm2 A T 11: 74,853,848 C848* probably null Het
Slc39a10 A T 1: 46,819,262 V625E probably benign Het
Spry4 C T 18: 38,590,577 M44I probably benign Het
Tas2r126 T C 6: 42,435,136 I201T probably benign Het
Tex44 A G 1: 86,427,646 T426A probably benign Het
Tln2 T C 9: 67,272,668 D807G possibly damaging Het
Tlr9 A G 9: 106,223,750 N80S probably benign Het
Trpm7 A C 2: 126,830,162 H579Q probably benign Het
Ufd1 T C 16: 18,814,911 S29P probably damaging Het
Ugt2a3 G T 5: 87,325,598 Q487K probably damaging Het
Wdr66 T C 5: 123,287,345 V789A probably benign Het
Zfyve9 A G 4: 108,695,767 probably null Het
Other mutations in Stat5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02208:Stat5b APN 11 100804913 missense probably damaging 1.00
IGL02675:Stat5b APN 11 100787374 missense probably benign 0.26
IGL02683:Stat5b APN 11 100804946 missense probably benign 0.11
IGL02725:Stat5b APN 11 100805014 missense possibly damaging 0.91
R0305:Stat5b UTSW 11 100802503 missense probably benign 0.00
R0315:Stat5b UTSW 11 100788460 missense probably benign 0.01
R0452:Stat5b UTSW 11 100798330 missense probably benign 0.00
R1267:Stat5b UTSW 11 100798593 missense probably benign 0.08
R2059:Stat5b UTSW 11 100787332 missense probably benign 0.12
R2316:Stat5b UTSW 11 100796492 missense probably damaging 1.00
R2990:Stat5b UTSW 11 100808362 intron probably null
R4380:Stat5b UTSW 11 100787349 missense probably damaging 1.00
R4478:Stat5b UTSW 11 100787284 missense probably benign 0.31
R4584:Stat5b UTSW 11 100787238 missense probably damaging 1.00
R4806:Stat5b UTSW 11 100790797 missense probably benign
R4931:Stat5b UTSW 11 100784254 nonsense probably null
R5008:Stat5b UTSW 11 100802483 missense probably benign 0.00
R5015:Stat5b UTSW 11 100805005 missense possibly damaging 0.64
R5072:Stat5b UTSW 11 100808535 critical splice acceptor site probably null
R5601:Stat5b UTSW 11 100783175 missense probably damaging 0.99
R5638:Stat5b UTSW 11 100784254 nonsense probably null
R5901:Stat5b UTSW 11 100804907 missense possibly damaging 0.62
R6577:Stat5b UTSW 11 100797700 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTTCGTCTCCCTGCATCTAAAAGAAGG -3'
(R):5'- CCCGTGCATATTTACTCCAGTGGC -3'

Sequencing Primer
(F):5'- ctcctcctcctcctcttcc -3'
(R):5'- TTTGAAGGGAATGGGGACAAAC -3'
Posted On2014-04-13