Incidental Mutation 'R1499:Pum1'
ID168683
Institutional Source Beutler Lab
Gene Symbol Pum1
Ensembl Gene ENSMUSG00000028580
Gene Namepumilio RNA-binding family member 1
SynonymsPumm
MMRRC Submission 039550-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.873) question?
Stock #R1499 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location130663321-130781564 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 130719256 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 209 (S209P)
Ref Sequence ENSEMBL: ENSMUSP00000095476 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030315] [ENSMUST00000097862] [ENSMUST00000097864] [ENSMUST00000105991] [ENSMUST00000105992] [ENSMUST00000143277]
Predicted Effect probably damaging
Transcript: ENSMUST00000030315
AA Change: S209P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000030315
Gene: ENSMUSG00000028580
AA Change: S209P

DomainStartEndE-ValueType
low complexity region 45 58 N/A INTRINSIC
low complexity region 94 102 N/A INTRINSIC
low complexity region 393 414 N/A INTRINSIC
low complexity region 443 458 N/A INTRINSIC
low complexity region 476 503 N/A INTRINSIC
low complexity region 528 539 N/A INTRINSIC
low complexity region 584 615 N/A INTRINSIC
low complexity region 627 637 N/A INTRINSIC
low complexity region 643 666 N/A INTRINSIC
low complexity region 672 696 N/A INTRINSIC
low complexity region 731 741 N/A INTRINSIC
low complexity region 763 783 N/A INTRINSIC
low complexity region 798 816 N/A INTRINSIC
Pumilio 849 884 1.75e-6 SMART
Pumilio 885 920 4.03e-6 SMART
Pumilio 921 955 5.24e-5 SMART
Pumilio 959 994 3.37e-8 SMART
Pumilio 995 1030 6.29e-8 SMART
Pumilio 1031 1066 1.04e-8 SMART
Pumilio 1067 1102 6.2e-7 SMART
Pumilio 1110 1145 8.77e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000097862
AA Change: S209P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000095474
Gene: ENSMUSG00000028580
AA Change: S209P

DomainStartEndE-ValueType
low complexity region 45 58 N/A INTRINSIC
low complexity region 94 102 N/A INTRINSIC
low complexity region 393 414 N/A INTRINSIC
low complexity region 442 457 N/A INTRINSIC
low complexity region 475 502 N/A INTRINSIC
low complexity region 527 538 N/A INTRINSIC
low complexity region 583 614 N/A INTRINSIC
low complexity region 626 636 N/A INTRINSIC
low complexity region 642 665 N/A INTRINSIC
low complexity region 671 695 N/A INTRINSIC
low complexity region 730 740 N/A INTRINSIC
low complexity region 762 782 N/A INTRINSIC
low complexity region 797 815 N/A INTRINSIC
Pumilio 848 883 1.75e-6 SMART
Pumilio 884 919 4.03e-6 SMART
Pumilio 920 954 5.24e-5 SMART
Pumilio 958 993 3.37e-8 SMART
Pumilio 994 1029 6.29e-8 SMART
Pumilio 1030 1065 1.04e-8 SMART
Pumilio 1066 1101 6.2e-7 SMART
Pumilio 1109 1144 8.77e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000097864
AA Change: S209P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000095476
Gene: ENSMUSG00000028580
AA Change: S209P

DomainStartEndE-ValueType
low complexity region 45 58 N/A INTRINSIC
low complexity region 94 102 N/A INTRINSIC
low complexity region 393 414 N/A INTRINSIC
low complexity region 442 457 N/A INTRINSIC
low complexity region 475 502 N/A INTRINSIC
low complexity region 527 538 N/A INTRINSIC
low complexity region 583 614 N/A INTRINSIC
low complexity region 626 636 N/A INTRINSIC
low complexity region 642 665 N/A INTRINSIC
low complexity region 671 695 N/A INTRINSIC
low complexity region 730 740 N/A INTRINSIC
low complexity region 762 782 N/A INTRINSIC
low complexity region 797 815 N/A INTRINSIC
Pumilio 848 883 1.75e-6 SMART
Pumilio 884 919 4.03e-6 SMART
Pumilio 920 955 5.48e-8 SMART
Pumilio 956 991 3.37e-8 SMART
Pumilio 992 1027 6.29e-8 SMART
Pumilio 1028 1063 1.04e-8 SMART
Pumilio 1064 1099 6.2e-7 SMART
Pumilio 1107 1142 8.77e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105991
SMART Domains Protein: ENSMUSP00000101612
Gene: ENSMUSG00000028580

DomainStartEndE-ValueType
low complexity region 45 58 N/A INTRINSIC
low complexity region 94 102 N/A INTRINSIC
low complexity region 151 172 N/A INTRINSIC
low complexity region 200 215 N/A INTRINSIC
low complexity region 233 260 N/A INTRINSIC
low complexity region 285 296 N/A INTRINSIC
low complexity region 341 372 N/A INTRINSIC
low complexity region 384 394 N/A INTRINSIC
low complexity region 400 423 N/A INTRINSIC
low complexity region 429 453 N/A INTRINSIC
low complexity region 488 498 N/A INTRINSIC
low complexity region 520 540 N/A INTRINSIC
low complexity region 555 573 N/A INTRINSIC
Pumilio 606 641 1.75e-6 SMART
Pumilio 642 677 4.03e-6 SMART
Pumilio 678 713 5.48e-8 SMART
Pumilio 714 749 3.37e-8 SMART
Pumilio 750 785 6.29e-8 SMART
Pumilio 786 821 1.04e-8 SMART
Pumilio 822 857 6.2e-7 SMART
Pumilio 865 900 8.77e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105992
SMART Domains Protein: ENSMUSP00000101613
Gene: ENSMUSG00000028580

DomainStartEndE-ValueType
low complexity region 45 58 N/A INTRINSIC
low complexity region 94 102 N/A INTRINSIC
low complexity region 297 318 N/A INTRINSIC
low complexity region 346 361 N/A INTRINSIC
low complexity region 379 406 N/A INTRINSIC
low complexity region 431 442 N/A INTRINSIC
low complexity region 487 518 N/A INTRINSIC
low complexity region 530 540 N/A INTRINSIC
low complexity region 546 569 N/A INTRINSIC
low complexity region 575 599 N/A INTRINSIC
low complexity region 634 644 N/A INTRINSIC
low complexity region 666 686 N/A INTRINSIC
low complexity region 701 719 N/A INTRINSIC
Pumilio 752 787 1.75e-6 SMART
Pumilio 788 823 4.03e-6 SMART
Pumilio 824 858 5.24e-5 SMART
Pumilio 862 897 3.37e-8 SMART
Pumilio 898 933 6.29e-8 SMART
Pumilio 934 969 1.04e-8 SMART
Pumilio 970 1005 6.2e-7 SMART
Pumilio 1013 1048 8.77e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122847
Predicted Effect probably benign
Transcript: ENSMUST00000143277
SMART Domains Protein: ENSMUSP00000114629
Gene: ENSMUSG00000028580

DomainStartEndE-ValueType
low complexity region 45 58 N/A INTRINSIC
low complexity region 94 102 N/A INTRINSIC
low complexity region 151 172 N/A INTRINSIC
low complexity region 200 215 N/A INTRINSIC
Meta Mutation Damage Score 0.404 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.4%
Validation Efficiency 99% (83/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the PUF family, evolutionarily conserved RNA-binding proteins related to the Pumilio proteins of Drosophila and the fem-3 mRNA binding factor proteins of C. elegans. The encoded protein contains a sequence-specific RNA binding domain comprised of eight repeats and N- and C-terminal flanking regions, and serves as a translational regulator of specific mRNAs by binding to their 3' untranslated regions. The evolutionarily conserved function of the encoded protein in invertebrates and lower vertebrates suggests that the human protein may be involved in translational regulation of embryogenesis, and cell development and differentiation. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased testes weight and size, decreased body weight, oligozoospermia, reduced male fertility, increased male germ cell apoptosis and small seminiferous tubules. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik A T 6: 40,921,718 S199T probably benign Het
Abca9 T A 11: 110,139,632 Y763F probably benign Het
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Actl11 A G 9: 107,931,483 T1002A probably damaging Het
Ampd1 T A 3: 103,091,664 N378K probably damaging Het
Arhgap42 A G 9: 9,033,586 probably benign Het
Arhgap6 C A X: 168,796,503 P95T possibly damaging Het
Atg14 T C 14: 47,560,645 N87S probably benign Het
Atp9b C T 18: 80,762,138 C735Y probably damaging Het
Atp9b T A 18: 80,778,907 T110S probably benign Het
Birc6 T G 17: 74,612,319 L221R probably damaging Het
Ces1c A G 8: 93,127,605 F101L probably benign Het
Chsy1 T C 7: 66,172,002 Y662H probably damaging Het
Cldn12 A T 5: 5,507,900 F176I probably benign Het
Col5a2 A G 1: 45,411,466 S374P probably benign Het
Col6a2 A T 10: 76,603,710 V740E probably damaging Het
Cpne3 A T 4: 19,526,336 I401K probably damaging Het
Cspp1 T A 1: 10,088,966 probably null Het
Ddn G A 15: 98,806,766 T215I possibly damaging Het
Dync1i1 T C 6: 5,769,799 probably benign Het
Dync2li1 T C 17: 84,647,239 probably benign Het
Eif2a T A 3: 58,537,584 L50* probably null Het
Elavl3 G A 9: 22,018,579 A343V probably damaging Het
Fastkd1 T C 2: 69,708,638 probably null Het
Fgf8 C A 19: 45,742,347 V80F possibly damaging Het
Fras1 A T 5: 96,743,187 E2858D probably benign Het
Fshr A T 17: 88,986,101 L383Q probably damaging Het
Glb1 A G 9: 114,417,103 K74R probably benign Het
Gmeb2 T G 2: 181,255,226 M290L probably benign Het
Gnptg A G 17: 25,235,854 probably null Het
Grik2 A C 10: 49,132,775 S739A probably damaging Het
Grk2 T A 19: 4,287,194 Q659L probably benign Het
Hdhd5 A G 6: 120,514,512 V210A probably damaging Het
Hyal1 C T 9: 107,577,892 L134F probably damaging Het
Itgb2 A T 10: 77,546,153 K18N possibly damaging Het
Jam3 A T 9: 27,106,405 I29K possibly damaging Het
Kcnh3 C A 15: 99,239,915 D830E probably benign Het
Kcnmb4 T C 10: 116,473,298 D75G possibly damaging Het
Kdm4b A G 17: 56,400,025 Y981C probably damaging Het
Klk1b26 C A 7: 44,016,386 D207E probably benign Het
Kmt2a G T 9: 44,848,266 T762N probably benign Het
Kmt2d A G 15: 98,844,938 probably benign Het
Lama4 T C 10: 39,088,880 S1414P possibly damaging Het
Lce1f C G 3: 92,718,969 C127S unknown Het
Maats1 A G 16: 38,321,400 V390A probably damaging Het
Map7d1 A G 4: 126,234,765 probably null Het
Ninl T C 2: 150,980,176 D2G possibly damaging Het
Olfr1029 C T 2: 85,976,028 P262S possibly damaging Het
Olfr1369-ps1 T A 13: 21,116,133 M147K probably benign Het
Olfr1537 G C 9: 39,238,251 P58A probably benign Het
Olfr195 A G 16: 59,148,924 T25A probably benign Het
Olfr429 T A 1: 174,089,247 L69* probably null Het
Pax8 A G 2: 24,429,596 Y381H possibly damaging Het
Pde7a T C 3: 19,260,244 I63V possibly damaging Het
Pgm3 A T 9: 86,570,287 F40Y probably benign Het
Phrf1 G T 7: 141,256,651 D78Y probably damaging Het
Plekhg1 C T 10: 3,940,538 probably benign Het
Qtrt2 A T 16: 43,868,974 F220L probably benign Het
Rgs9 A G 11: 109,268,921 probably null Het
Rin3 A G 12: 102,368,759 T230A unknown Het
Ros1 A T 10: 52,098,677 V1604E possibly damaging Het
Rpp14 A G 14: 8,090,528 M151V probably benign Het
Sacs T A 14: 61,213,704 F4400I possibly damaging Het
Scamp1 C T 13: 94,224,929 V148I probably benign Het
Slc13a5 A G 11: 72,250,731 C428R probably damaging Het
Slc43a2 T G 11: 75,562,907 probably null Het
Smarcc2 T A 10: 128,463,872 N135K probably damaging Het
Snx15 G C 19: 6,122,064 S116R probably damaging Het
Stag1 A G 9: 100,855,832 E414G possibly damaging Het
Stag1 A T 9: 100,887,373 probably benign Het
Tmem106a T A 11: 101,590,437 L257Q possibly damaging Het
Tnc C T 4: 63,964,754 D1968N probably benign Het
Trim42 A G 9: 97,366,085 L186P possibly damaging Het
Tshb T A 3: 102,778,308 probably benign Het
Ttn T A 2: 76,754,140 D13881V probably damaging Het
Uqcrc2 T C 7: 120,640,283 V56A probably benign Het
Uty G A Y: 1,197,228 T113I probably damaging Het
Vps13c A G 9: 67,957,505 E3032G probably benign Het
Wfdc9 T G 2: 164,651,809 probably benign Het
Zc3h7a G A 16: 11,162,656 T31I probably damaging Het
Zfp462 T C 4: 55,060,046 S1191P probably damaging Het
Other mutations in Pum1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00985:Pum1 APN 4 130743789 missense probably damaging 1.00
IGL01327:Pum1 APN 4 130730543 missense probably damaging 0.97
IGL01360:Pum1 APN 4 130728170 intron probably benign
IGL02055:Pum1 APN 4 130754054 missense probably benign 0.19
IGL02713:Pum1 APN 4 130766012 missense probably damaging 1.00
IGL03401:Pum1 APN 4 130743681 splice site probably benign
LCD18:Pum1 UTSW 4 130730549 intron probably benign
R0077:Pum1 UTSW 4 130772674 missense probably benign 0.06
R0346:Pum1 UTSW 4 130779805 missense possibly damaging 0.74
R0632:Pum1 UTSW 4 130728104 missense probably benign 0.34
R0870:Pum1 UTSW 4 130768844 missense probably damaging 0.99
R1006:Pum1 UTSW 4 130771888 missense probably damaging 0.98
R1300:Pum1 UTSW 4 130765961 missense probably damaging 1.00
R1572:Pum1 UTSW 4 130718204 missense probably damaging 0.99
R1835:Pum1 UTSW 4 130701048 missense possibly damaging 0.93
R1864:Pum1 UTSW 4 130751525 missense possibly damaging 0.90
R1991:Pum1 UTSW 4 130718218 missense possibly damaging 0.93
R2068:Pum1 UTSW 4 130774434 missense probably benign 0.02
R2119:Pum1 UTSW 4 130669270 missense possibly damaging 0.92
R2120:Pum1 UTSW 4 130669270 missense possibly damaging 0.92
R2122:Pum1 UTSW 4 130669270 missense possibly damaging 0.92
R2153:Pum1 UTSW 4 130751491 missense probably damaging 1.00
R2164:Pum1 UTSW 4 130728083 nonsense probably null
R2164:Pum1 UTSW 4 130728084 missense probably damaging 0.99
R2280:Pum1 UTSW 4 130766011 missense probably damaging 1.00
R3116:Pum1 UTSW 4 130772660 missense probably damaging 1.00
R3890:Pum1 UTSW 4 130764082 missense probably damaging 1.00
R3891:Pum1 UTSW 4 130764082 missense probably damaging 1.00
R3892:Pum1 UTSW 4 130764082 missense probably damaging 1.00
R4134:Pum1 UTSW 4 130764069 missense probably damaging 1.00
R4258:Pum1 UTSW 4 130730280 missense probably damaging 1.00
R4731:Pum1 UTSW 4 130718193 missense probably benign 0.00
R4732:Pum1 UTSW 4 130718193 missense probably benign 0.00
R4733:Pum1 UTSW 4 130718193 missense probably benign 0.00
R4973:Pum1 UTSW 4 130669137 missense probably benign 0.27
R5198:Pum1 UTSW 4 130779879 nonsense probably null
R5249:Pum1 UTSW 4 130762814 missense probably benign 0.07
R5478:Pum1 UTSW 4 130751484 missense possibly damaging 0.93
R5652:Pum1 UTSW 4 130764127 missense possibly damaging 0.95
R5932:Pum1 UTSW 4 130730366 missense probably benign 0.04
R6008:Pum1 UTSW 4 130768847 missense probably damaging 1.00
R6112:Pum1 UTSW 4 130730280 missense probably damaging 1.00
R6416:Pum1 UTSW 4 130728287 unclassified probably null
R6426:Pum1 UTSW 4 130753972 missense probably damaging 1.00
R6431:Pum1 UTSW 4 130774505 missense probably damaging 1.00
R7226:Pum1 UTSW 4 130771981 missense probably damaging 1.00
R7273:Pum1 UTSW 4 130751480 missense probably damaging 0.99
R7423:Pum1 UTSW 4 130774545 missense probably damaging 1.00
X0024:Pum1 UTSW 4 130779790 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGGTCTCCTGATTCCCAGACATTG -3'
(R):5'- CCTCATGCAGATACCCAACTTGTCC -3'

Sequencing Primer
(F):5'- CCCAGACATTGGTTTATCACGAG -3'
(R):5'- AAGTGCAGTTTGCCTGTCC -3'
Posted On2014-04-13