Incidental Mutation 'R1586:Ulk1'
ID177502
Institutional Source Beutler Lab
Gene Symbol Ulk1
Ensembl Gene ENSMUSG00000029512
Gene Nameunc-51 like kinase 1
SynonymsUnc51.1
MMRRC Submission 039623-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1586 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location110784488-110810097 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 110789516 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 638 (F638Y)
Ref Sequence ENSEMBL: ENSMUSP00000143536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031490] [ENSMUST00000196094] [ENSMUST00000198561] [ENSMUST00000200299]
Predicted Effect probably damaging
Transcript: ENSMUST00000031490
AA Change: F632Y

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000031490
Gene: ENSMUSG00000029512
AA Change: F632Y

DomainStartEndE-ValueType
S_TKc 16 278 3.6e-98 SMART
low complexity region 287 318 N/A INTRINSIC
low complexity region 340 356 N/A INTRINSIC
low complexity region 400 423 N/A INTRINSIC
Blast:S_TKc 459 837 1e-131 BLAST
Pfam:DUF3543 838 1048 1.8e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196094
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196440
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196883
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197768
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198470
Predicted Effect probably benign
Transcript: ENSMUST00000198561
SMART Domains Protein: ENSMUSP00000143308
Gene: ENSMUSG00000029512

DomainStartEndE-ValueType
Blast:S_TKc 1 75 5e-24 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199568
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199717
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200099
Predicted Effect probably damaging
Transcript: ENSMUST00000200299
AA Change: F638Y

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000143536
Gene: ENSMUSG00000029512
AA Change: F638Y

DomainStartEndE-ValueType
S_TKc 16 278 7.47e-96 SMART
low complexity region 287 318 N/A INTRINSIC
low complexity region 340 356 N/A INTRINSIC
low complexity region 400 423 N/A INTRINSIC
Blast:S_TKc 459 843 1e-129 BLAST
Pfam:DUF3543 844 1054 1.4e-29 PFAM
Meta Mutation Damage Score 0.13 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 88.8%
Validation Efficiency 93% (65/70)
MGI Phenotype PHENOTYPE: Null homozygotes have blood defects including an increase in mean corpuscular volume and the presence of red blood cells that contain mitochondria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A G 4: 42,971,512 I282V probably benign Het
9030624J02Rik T A 7: 118,809,972 I612N probably damaging Het
Abca2 C T 2: 25,447,216 A2361V probably damaging Het
Alpi A G 1: 87,100,201 I219T probably damaging Het
Anapc10 T A 8: 79,775,143 M180K probably benign Het
Ank3 A G 10: 69,877,878 I431V probably damaging Het
Anxa8 T A 14: 34,093,937 D182E probably damaging Het
Atp1a3 T A 7: 24,979,383 I945F probably damaging Het
Atp2a3 T C 11: 72,991,744 S1019P probably damaging Het
Cbs T A 17: 31,622,474 I258F probably damaging Het
Cic T C 7: 25,285,961 S277P probably damaging Het
Cidea T A 18: 67,360,160 V83E probably damaging Het
Cilp G A 9: 65,279,715 G1031S probably damaging Het
Clca3a2 A G 3: 144,810,716 I373T possibly damaging Het
Cpvl T A 6: 53,926,901 D293V probably damaging Het
Cryz A G 3: 154,611,510 N122S probably benign Het
Dmap1 T C 4: 117,676,122 E245G probably damaging Het
Epha2 C T 4: 141,318,605 probably benign Het
Fam222b C T 11: 78,154,521 L303F probably damaging Het
Fastkd1 T C 2: 69,712,148 D105G probably benign Het
Fat4 T A 3: 38,888,860 L634Q probably damaging Het
Fbxo10 A T 4: 45,042,036 I731N possibly damaging Het
Fig4 A G 10: 41,265,427 F279L probably damaging Het
Guk1 A G 11: 59,186,849 S22P probably damaging Het
Kmt2d A G 15: 98,865,053 probably benign Het
Macf1 A T 4: 123,509,846 S727T probably benign Het
Mgea5 T G 19: 45,776,910 T153P possibly damaging Het
Mki67 T A 7: 135,713,972 K54* probably null Het
Ms4a8a T C 19: 11,076,332 T137A possibly damaging Het
Myo5c T C 9: 75,267,031 Y557H probably damaging Het
Nav3 T A 10: 109,853,254 K387N probably damaging Het
Olfr1432 G T 19: 12,228,877 A223E probably damaging Het
Pde4c T A 8: 70,746,859 Y223N probably damaging Het
Psd T G 19: 46,314,798 E715A probably damaging Het
Rpl7 A T 1: 16,102,583 S171T probably benign Het
Rrm1 A G 7: 102,466,905 *66W probably null Het
Scgb1b3 T A 7: 31,375,963 H79Q probably damaging Het
Serpinb9 A T 13: 33,015,486 M255L probably benign Het
Slc35a4 T C 18: 36,683,005 V296A probably benign Het
Smgc G A 15: 91,838,393 A9T possibly damaging Het
Snx11 C A 11: 96,770,696 W161L probably benign Het
Spag17 A G 3: 100,021,752 K533E possibly damaging Het
Speer4b A G 5: 27,497,013 S250P probably damaging Het
Spta1 A T 1: 174,213,495 H1287L probably benign Het
Surf2 T C 2: 26,919,755 F239S probably damaging Het
Tada1 G A 1: 166,386,750 R106H possibly damaging Het
Tbc1d22a C A 15: 86,351,651 probably null Het
Tbcd A G 11: 121,497,060 Q339R probably benign Het
Tdrd7 A G 4: 45,994,445 H281R probably benign Het
Tomm5 A G 4: 45,107,915 probably null Het
Ttc7 T C 17: 87,361,945 probably null Het
Wdr93 C A 7: 79,768,361 D277E probably damaging Het
Znrf3 T C 11: 5,281,477 R583G probably damaging Het
Zscan29 T A 2: 121,161,160 I716F probably damaging Het
Other mutations in Ulk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Ulk1 APN 5 110787872 missense probably damaging 1.00
IGL00916:Ulk1 APN 5 110793011 missense probably damaging 1.00
IGL00951:Ulk1 APN 5 110792404 missense possibly damaging 0.85
IGL02404:Ulk1 APN 5 110796234 splice site probably null
IGL02415:Ulk1 APN 5 110787621 missense probably damaging 1.00
IGL02500:Ulk1 APN 5 110809134 missense probably damaging 1.00
IGL02696:Ulk1 APN 5 110793052 missense probably damaging 1.00
R0086:Ulk1 UTSW 5 110787707 splice site probably benign
R0092:Ulk1 UTSW 5 110796327 missense probably null 1.00
R0158:Ulk1 UTSW 5 110788944 splice site probably benign
R0387:Ulk1 UTSW 5 110788797 missense possibly damaging 0.91
R0453:Ulk1 UTSW 5 110791085 missense probably damaging 1.00
R0837:Ulk1 UTSW 5 110789545 splice site probably benign
R1244:Ulk1 UTSW 5 110789357 missense probably benign 0.03
R1245:Ulk1 UTSW 5 110789340 critical splice donor site probably null
R1268:Ulk1 UTSW 5 110790277 missense probably damaging 1.00
R1342:Ulk1 UTSW 5 110789357 missense probably benign 0.03
R1590:Ulk1 UTSW 5 110795766 missense probably damaging 1.00
R1816:Ulk1 UTSW 5 110787831 missense probably damaging 1.00
R1837:Ulk1 UTSW 5 110789381 missense probably damaging 1.00
R1924:Ulk1 UTSW 5 110791070 missense probably damaging 0.97
R1992:Ulk1 UTSW 5 110787151 missense probably damaging 1.00
R2126:Ulk1 UTSW 5 110792436 missense probably benign 0.27
R2276:Ulk1 UTSW 5 110788162 missense probably benign 0.00
R2310:Ulk1 UTSW 5 110789357 missense probably benign 0.03
R2311:Ulk1 UTSW 5 110789357 missense probably benign 0.03
R2312:Ulk1 UTSW 5 110789357 missense probably benign 0.03
R2760:Ulk1 UTSW 5 110789357 missense probably benign 0.03
R2762:Ulk1 UTSW 5 110789357 missense probably benign 0.03
R2763:Ulk1 UTSW 5 110789357 missense probably benign 0.03
R2764:Ulk1 UTSW 5 110789357 missense probably benign 0.03
R2859:Ulk1 UTSW 5 110794629 missense probably damaging 1.00
R2932:Ulk1 UTSW 5 110789357 missense probably benign 0.03
R3760:Ulk1 UTSW 5 110789357 missense probably benign 0.03
R3761:Ulk1 UTSW 5 110789357 missense probably benign 0.03
R3762:Ulk1 UTSW 5 110789357 missense probably benign 0.03
R3763:Ulk1 UTSW 5 110789357 missense probably benign 0.03
R4334:Ulk1 UTSW 5 110789357 missense probably benign 0.03
R4419:Ulk1 UTSW 5 110789357 missense probably benign 0.03
R4471:Ulk1 UTSW 5 110789357 missense probably benign 0.03
R4615:Ulk1 UTSW 5 110789046 missense probably damaging 1.00
R4776:Ulk1 UTSW 5 110788947 critical splice donor site probably null
R4820:Ulk1 UTSW 5 110792130 missense probably benign
R4912:Ulk1 UTSW 5 110787589 missense probably damaging 1.00
R6299:Ulk1 UTSW 5 110791097 missense possibly damaging 0.78
R6754:Ulk1 UTSW 5 110790393 missense possibly damaging 0.91
R7233:Ulk1 UTSW 5 110809042 missense probably damaging 1.00
X0025:Ulk1 UTSW 5 110792129 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCCAGGCATAACTAGACTCAGCTTC -3'
(R):5'- AGCACCGCCTCATGATTTCAGAAC -3'

Sequencing Primer
(F):5'- GAGAACAGCTCCTGAGCAGTC -3'
(R):5'- CTCATGATTTCAGAACCTGTACACG -3'
Posted On2014-04-24