Incidental Mutation 'R2311:Ulk1'
ID245340
Institutional Source Beutler Lab
Gene Symbol Ulk1
Ensembl Gene ENSMUSG00000029512
Gene Nameunc-51 like kinase 1
SynonymsUnc51.1
MMRRC Submission 040310-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2311 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location110784488-110810097 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 110789357 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 691 (R691Q)
Ref Sequence ENSEMBL: ENSMUSP00000143536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031490] [ENSMUST00000196094] [ENSMUST00000198561] [ENSMUST00000200299]
Predicted Effect probably benign
Transcript: ENSMUST00000031490
AA Change: R685Q

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000031490
Gene: ENSMUSG00000029512
AA Change: R685Q

DomainStartEndE-ValueType
S_TKc 16 278 3.6e-98 SMART
low complexity region 287 318 N/A INTRINSIC
low complexity region 340 356 N/A INTRINSIC
low complexity region 400 423 N/A INTRINSIC
Blast:S_TKc 459 837 1e-131 BLAST
Pfam:DUF3543 838 1048 1.8e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196094
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196440
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196883
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197768
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198470
Predicted Effect probably benign
Transcript: ENSMUST00000198561
SMART Domains Protein: ENSMUSP00000143308
Gene: ENSMUSG00000029512

DomainStartEndE-ValueType
Blast:S_TKc 1 75 5e-24 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199568
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199717
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200099
Predicted Effect probably benign
Transcript: ENSMUST00000200299
AA Change: R691Q

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000143536
Gene: ENSMUSG00000029512
AA Change: R691Q

DomainStartEndE-ValueType
S_TKc 16 278 7.47e-96 SMART
low complexity region 287 318 N/A INTRINSIC
low complexity region 340 356 N/A INTRINSIC
low complexity region 400 423 N/A INTRINSIC
Blast:S_TKc 459 843 1e-129 BLAST
Pfam:DUF3543 844 1054 1.4e-29 PFAM
Meta Mutation Damage Score 0.09 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (41/41)
MGI Phenotype PHENOTYPE: Null homozygotes have blood defects including an increase in mean corpuscular volume and the presence of red blood cells that contain mitochondria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apol7e G A 15: 77,718,036 R278H probably benign Het
Arhgef17 A G 7: 100,928,904 S946P probably benign Het
Capsl A T 15: 9,462,603 R110* probably null Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Dock8 T A 19: 25,183,004 I1757N possibly damaging Het
Dthd1 T C 5: 62,839,237 probably benign Het
Eif5a2 A G 3: 28,782,176 E42G possibly damaging Het
Elovl3 A G 19: 46,133,200 S61G probably benign Het
Elp4 T C 2: 105,842,332 N136S probably benign Het
Elp6 A G 9: 110,320,818 S223G probably benign Het
Eml1 T A 12: 108,537,416 D743E probably damaging Het
Ezh2 T C 6: 47,558,260 Q85R probably damaging Het
Fermt3 C A 19: 7,014,162 C194F probably damaging Het
Flg A G 3: 93,292,953 probably benign Het
Gfi1b C T 2: 28,610,174 G282R probably damaging Het
Gm8979 T C 7: 106,083,590 K153E probably damaging Het
Gpr176 A T 2: 118,279,446 I444K probably benign Het
Gys2 A T 6: 142,463,244 M95K possibly damaging Het
Hgs C T 11: 120,479,648 R167W probably damaging Het
Map3k20 T C 2: 72,368,440 I130T probably damaging Het
Nckap5 A T 1: 126,528,752 Y25N probably damaging Het
Npc1 C T 18: 12,202,183 V629I probably benign Het
Nrl C A 14: 55,522,452 S6I probably damaging Het
Olfr1164 T C 2: 88,093,834 N34S probably benign Het
Olfr1209 T A 2: 88,909,469 D308V probably benign Het
Olfr1349 A T 7: 6,514,742 M229K probably benign Het
Oxct2b T C 4: 123,117,418 F377S probably damaging Het
Plb1 T C 5: 32,269,818 S91P probably benign Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Postn A T 3: 54,385,223 Y737F probably damaging Het
Serpina1e T A 12: 103,951,129 I94F possibly damaging Het
Serpine2 A G 1: 79,810,548 probably benign Het
Stox2 T C 8: 47,191,978 R816G probably damaging Het
Tep1 T C 14: 50,833,567 N2092D possibly damaging Het
Tmem186 A G 16: 8,635,884 V171A probably benign Het
Trim58 G A 11: 58,643,108 V163M probably benign Het
Trim59 G T 3: 69,037,829 C59* probably null Het
Vill A G 9: 119,065,897 N61S probably benign Het
Zer1 C T 2: 30,101,822 R662H probably damaging Het
Zfp644 A C 5: 106,634,956 V1184G probably benign Het
Zfp974 A G 7: 27,910,441 S620P possibly damaging Het
Other mutations in Ulk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Ulk1 APN 5 110787872 missense probably damaging 1.00
IGL00916:Ulk1 APN 5 110793011 missense probably damaging 1.00
IGL00951:Ulk1 APN 5 110792404 missense possibly damaging 0.85
IGL02404:Ulk1 APN 5 110796234 splice site probably null
IGL02415:Ulk1 APN 5 110787621 missense probably damaging 1.00
IGL02500:Ulk1 APN 5 110809134 missense probably damaging 1.00
IGL02696:Ulk1 APN 5 110793052 missense probably damaging 1.00
R0086:Ulk1 UTSW 5 110787707 splice site probably benign
R0092:Ulk1 UTSW 5 110796327 missense probably null 1.00
R0158:Ulk1 UTSW 5 110788944 splice site probably benign
R0387:Ulk1 UTSW 5 110788797 missense possibly damaging 0.91
R0453:Ulk1 UTSW 5 110791085 missense probably damaging 1.00
R0837:Ulk1 UTSW 5 110789545 splice site probably benign
R1244:Ulk1 UTSW 5 110789357 missense probably benign 0.03
R1245:Ulk1 UTSW 5 110789340 critical splice donor site probably null
R1268:Ulk1 UTSW 5 110790277 missense probably damaging 1.00
R1342:Ulk1 UTSW 5 110789357 missense probably benign 0.03
R1586:Ulk1 UTSW 5 110789516 missense probably damaging 1.00
R1590:Ulk1 UTSW 5 110795766 missense probably damaging 1.00
R1816:Ulk1 UTSW 5 110787831 missense probably damaging 1.00
R1837:Ulk1 UTSW 5 110789381 missense probably damaging 1.00
R1924:Ulk1 UTSW 5 110791070 missense probably damaging 0.97
R1992:Ulk1 UTSW 5 110787151 missense probably damaging 1.00
R2126:Ulk1 UTSW 5 110792436 missense probably benign 0.27
R2276:Ulk1 UTSW 5 110788162 missense probably benign 0.00
R2310:Ulk1 UTSW 5 110789357 missense probably benign 0.03
R2312:Ulk1 UTSW 5 110789357 missense probably benign 0.03
R2760:Ulk1 UTSW 5 110789357 missense probably benign 0.03
R2762:Ulk1 UTSW 5 110789357 missense probably benign 0.03
R2763:Ulk1 UTSW 5 110789357 missense probably benign 0.03
R2764:Ulk1 UTSW 5 110789357 missense probably benign 0.03
R2859:Ulk1 UTSW 5 110794629 missense probably damaging 1.00
R2932:Ulk1 UTSW 5 110789357 missense probably benign 0.03
R3760:Ulk1 UTSW 5 110789357 missense probably benign 0.03
R3761:Ulk1 UTSW 5 110789357 missense probably benign 0.03
R3762:Ulk1 UTSW 5 110789357 missense probably benign 0.03
R3763:Ulk1 UTSW 5 110789357 missense probably benign 0.03
R4334:Ulk1 UTSW 5 110789357 missense probably benign 0.03
R4419:Ulk1 UTSW 5 110789357 missense probably benign 0.03
R4471:Ulk1 UTSW 5 110789357 missense probably benign 0.03
R4615:Ulk1 UTSW 5 110789046 missense probably damaging 1.00
R4776:Ulk1 UTSW 5 110788947 critical splice donor site probably null
R4820:Ulk1 UTSW 5 110792130 missense probably benign
R4912:Ulk1 UTSW 5 110787589 missense probably damaging 1.00
R6299:Ulk1 UTSW 5 110791097 missense possibly damaging 0.78
R6754:Ulk1 UTSW 5 110790393 missense possibly damaging 0.91
R7233:Ulk1 UTSW 5 110809042 missense probably damaging 1.00
X0025:Ulk1 UTSW 5 110792129 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGCCAGGCATAACTAGACTCAG -3'
(R):5'- CCATGGGACTTTCTCAGTGC -3'

Sequencing Primer
(F):5'- GGCATAACTAGACTCAGCTTCAGTC -3'
(R):5'- TTTCCCTCCTAGGCCGGG -3'
Posted On2014-10-30