Incidental Mutation 'R1660:Chrm1'
ID186706
Institutional Source Beutler Lab
Gene Symbol Chrm1
Ensembl Gene ENSMUSG00000032773
Gene Namecholinergic receptor, muscarinic 1, CNS
Synonymsmuscarinic acetylcholine receptor 1, M1R, M1, AW495047, Chrm-1
MMRRC Submission 039696-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R1660 (G1)
Quality Score153
Status Not validated
Chromosome19
Chromosomal Location8663789-8683587 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 8679218 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 429 (F429S)
Ref Sequence ENSEMBL: ENSMUSP00000126103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035444] [ENSMUST00000163785] [ENSMUST00000177197]
Predicted Effect possibly damaging
Transcript: ENSMUST00000035444
AA Change: F429S

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000042632
Gene: ENSMUSG00000032773
AA Change: F429S

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 36 227 1.7e-7 PFAM
Pfam:7tm_1 42 418 1.9e-97 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157205
Predicted Effect possibly damaging
Transcript: ENSMUST00000163785
AA Change: F429S

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000126103
Gene: ENSMUSG00000032773
AA Change: F429S

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 36 227 1.7e-7 PFAM
Pfam:7tm_1 42 418 2.9e-83 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177197
SMART Domains Protein: ENSMUSP00000135356
Gene: ENSMUSG00000032773

DomainStartEndE-ValueType
Pfam:7tm_1 42 74 1.6e-9 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The muscarinic cholinergic receptors belong to a larger family of G protein-coupled receptors. The functional diversity of these receptors is defined by the binding of acetylcholine and includes cellular responses such as adenylate cyclase inhibition, phosphoinositide degeneration, and potassium channel mediation. Muscarinic receptors influence many effects of acetylcholine in the central and peripheral nervous system. The muscarinic cholinergic receptor 1 is involved in mediation of vagally-induced bronchoconstriction and in the acid secretion of the gastrointestinal tract. The gene encoding this receptor is localized to 11q13. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit resistance to pilocarpine-induced seizures, selective memory deficits, elevated dopaminergic transmission in the striatum, and increased spontaneous and amphetamine-induced locomotion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf C A 19: 31,893,107 S3* probably null Het
Adgrv1 C T 13: 81,476,631 V3740I probably benign Het
Aida T C 1: 183,297,583 F22S probably damaging Het
Ankrd65 A T 4: 155,792,071 D220V probably damaging Het
Antxr2 A T 5: 97,975,350 C279* probably null Het
Ap3b1 T C 13: 94,408,812 V191A probably damaging Het
Arhgef28 T C 13: 97,981,376 K595E probably benign Het
Atp12a A G 14: 56,370,848 T98A probably benign Het
Cdcp1 A T 9: 123,185,362 S116T probably benign Het
Ckap5 C A 2: 91,562,958 Q395K possibly damaging Het
Cntn4 T A 6: 106,679,297 I853K probably benign Het
Cyp2g1 G A 7: 26,809,682 probably null Het
Dhx57 C T 17: 80,245,728 V1257I possibly damaging Het
Disp1 A T 1: 183,087,742 V1038D probably damaging Het
Dmxl2 A T 9: 54,451,030 S462T possibly damaging Het
Exoc3l A G 8: 105,293,060 probably null Het
Fam210a T C 18: 68,276,096 T48A probably benign Het
Fbxw5 G A 2: 25,503,274 probably null Het
Fkbp9 T C 6: 56,873,449 C437R probably damaging Het
Gpc5 A G 14: 115,399,279 K458R probably benign Het
Grik2 C A 10: 49,244,343 G56* probably null Het
Igsf10 T C 3: 59,331,285 T492A probably damaging Het
Kif1c C T 11: 70,728,397 L953F probably damaging Het
Lrrc51 T C 7: 101,913,438 Y145C probably damaging Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Mapkbp1 A T 2: 120,018,548 I682F possibly damaging Het
Mttp A T 3: 138,103,193 V718D probably damaging Het
Myt1l T A 12: 29,895,273 D1012E unknown Het
Nbn G A 4: 15,971,771 G301D probably benign Het
Ncstn T A 1: 172,066,772 S677C possibly damaging Het
Nod1 C A 6: 54,944,233 probably null Het
Nos1ap A G 1: 170,514,637 V52A possibly damaging Het
Olfr1450 T A 19: 12,953,691 I34N probably damaging Het
Olfr191 T A 16: 59,086,343 I47F probably benign Het
Olfr568 T G 7: 102,877,656 Y179D probably damaging Het
Olfr619 T A 7: 103,603,675 L7* probably null Het
Phf13 T C 4: 151,992,505 I77V probably benign Het
Pias2 A G 18: 77,120,129 K230E probably damaging Het
Poli A G 18: 70,509,464 L469P probably damaging Het
Prag1 A T 8: 36,140,023 T973S possibly damaging Het
Prpf40b C A 15: 99,305,561 H101Q probably damaging Het
Prss50 T C 9: 110,862,489 V287A possibly damaging Het
Rbm25 C T 12: 83,668,150 probably benign Het
Rcor2 T C 19: 7,268,972 V4A probably damaging Het
Rnf180 T C 13: 105,270,991 T17A probably benign Het
Robo3 A T 9: 37,429,144 V179E probably damaging Het
Sacs T A 14: 61,209,009 S2835T probably damaging Het
Serpinb3c T A 1: 107,271,702 H363L probably damaging Het
Setd1a T C 7: 127,796,669 probably benign Het
Skp2 A C 15: 9,125,114 V126G probably benign Het
Snph G A 2: 151,594,478 Q108* probably null Het
Snrpa1 T A 7: 66,069,498 V144E probably damaging Het
Tifab T C 13: 56,176,435 E65G probably damaging Het
Tmem201 A T 4: 149,719,575 Y468N probably damaging Het
Tpcn1 T C 5: 120,549,515 N388S possibly damaging Het
Tssk4 A G 14: 55,650,572 Q75R probably null Het
Tuba4a T C 1: 75,215,903 N356D probably benign Het
Ugt2b5 T A 5: 87,139,618 D230V probably benign Het
Ush2a T C 1: 188,916,064 V4622A probably benign Het
Vmn2r11 T G 5: 109,053,858 Y260S possibly damaging Het
Vmn2r89 C A 14: 51,456,236 H348N possibly damaging Het
Vmn2r96 A T 17: 18,597,726 M714L probably benign Het
Wdr92 A T 11: 17,227,183 E180D probably benign Het
Zbtb18 T C 1: 177,447,763 S221P probably benign Het
Zfp418 A G 7: 7,181,790 T251A probably benign Het
Zmynd15 A G 11: 70,463,502 Y267C probably damaging Het
Other mutations in Chrm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00466:Chrm1 APN 19 8678074 missense probably benign 0.01
IGL01633:Chrm1 APN 19 8678495 missense probably benign 0.29
IGL01824:Chrm1 APN 19 8679130 missense probably damaging 0.98
IGL02539:Chrm1 APN 19 8678311 missense probably damaging 1.00
IGL03342:Chrm1 APN 19 8679308 missense probably benign 0.33
R1942:Chrm1 UTSW 19 8678273 missense probably damaging 0.99
R2208:Chrm1 UTSW 19 8678099 missense probably damaging 1.00
R6466:Chrm1 UTSW 19 8678178 nonsense probably null
R6535:Chrm1 UTSW 19 8679073 missense possibly damaging 0.93
R6720:Chrm1 UTSW 19 8678548 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGCCAAGAGAAAGACCTTCTCACTG -3'
(R):5'- TGGAAAGCGGCAAAGTCTCTCTG -3'

Sequencing Primer
(F):5'- GAAAGACCTTCTCACTGGTCAAG -3'
(R):5'- GCAAAGTCTCTCTGGGCTG -3'
Posted On2014-05-09