Incidental Mutation 'R1664:Plekha7'
ID187019
Institutional Source Beutler Lab
Gene Symbol Plekha7
Ensembl Gene ENSMUSG00000045659
Gene Namepleckstrin homology domain containing, family A member 7
SynonymsA430081P20Rik
MMRRC Submission 039700-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.217) question?
Stock #R1664 (G1)
Quality Score208
Status Not validated
Chromosome7
Chromosomal Location116123485-116308376 bp(-) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) C to A at 116135034 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000138257 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084664] [ENSMUST00000181981] [ENSMUST00000181998] [ENSMUST00000182487] [ENSMUST00000182511] [ENSMUST00000182834]
Predicted Effect probably null
Transcript: ENSMUST00000084664
SMART Domains Protein: ENSMUSP00000081714
Gene: ENSMUSG00000045659

DomainStartEndE-ValueType
Blast:PH 1 47 2e-23 BLAST
SCOP:d1kz7a2 18 69 1e-5 SMART
low complexity region 100 112 N/A INTRINSIC
low complexity region 141 154 N/A INTRINSIC
low complexity region 322 351 N/A INTRINSIC
coiled coil region 461 500 N/A INTRINSIC
coiled coil region 529 562 N/A INTRINSIC
low complexity region 677 693 N/A INTRINSIC
coiled coil region 828 856 N/A INTRINSIC
low complexity region 947 959 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000181981
AA Change: C1013F

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000138766
Gene: ENSMUSG00000045659
AA Change: C1013F

DomainStartEndE-ValueType
PH 59 178 1.42e-18 SMART
low complexity region 231 243 N/A INTRINSIC
low complexity region 272 285 N/A INTRINSIC
low complexity region 453 482 N/A INTRINSIC
coiled coil region 592 631 N/A INTRINSIC
coiled coil region 660 693 N/A INTRINSIC
low complexity region 808 824 N/A INTRINSIC
coiled coil region 959 987 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000181998
SMART Domains Protein: ENSMUSP00000138575
Gene: ENSMUSG00000045659

DomainStartEndE-ValueType
WW 9 41 4.51e-2 SMART
WW 54 86 7.79e-6 SMART
PH 164 283 1.42e-18 SMART
low complexity region 336 348 N/A INTRINSIC
low complexity region 377 390 N/A INTRINSIC
low complexity region 558 587 N/A INTRINSIC
coiled coil region 697 736 N/A INTRINSIC
coiled coil region 765 798 N/A INTRINSIC
low complexity region 913 929 N/A INTRINSIC
coiled coil region 1064 1092 N/A INTRINSIC
low complexity region 1183 1195 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000182443
Predicted Effect probably damaging
Transcript: ENSMUST00000182487
AA Change: C1118F

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000138214
Gene: ENSMUSG00000045659
AA Change: C1118F

DomainStartEndE-ValueType
WW 9 41 4.51e-2 SMART
WW 54 86 7.79e-6 SMART
PH 164 283 1.42e-18 SMART
low complexity region 336 348 N/A INTRINSIC
low complexity region 377 390 N/A INTRINSIC
low complexity region 558 587 N/A INTRINSIC
coiled coil region 697 736 N/A INTRINSIC
coiled coil region 765 798 N/A INTRINSIC
low complexity region 913 929 N/A INTRINSIC
coiled coil region 1064 1092 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000182511
AA Change: C1056F

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000138544
Gene: ENSMUSG00000045659
AA Change: C1056F

DomainStartEndE-ValueType
PH 102 221 1.42e-18 SMART
low complexity region 274 286 N/A INTRINSIC
low complexity region 315 328 N/A INTRINSIC
low complexity region 496 525 N/A INTRINSIC
coiled coil region 635 674 N/A INTRINSIC
coiled coil region 703 736 N/A INTRINSIC
low complexity region 851 867 N/A INTRINSIC
coiled coil region 1002 1030 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000182834
SMART Domains Protein: ENSMUSP00000138257
Gene: ENSMUSG00000045659

DomainStartEndE-ValueType
PH 118 237 1.42e-18 SMART
low complexity region 290 302 N/A INTRINSIC
low complexity region 331 344 N/A INTRINSIC
low complexity region 512 541 N/A INTRINSIC
coiled coil region 651 690 N/A INTRINSIC
coiled coil region 719 752 N/A INTRINSIC
low complexity region 867 883 N/A INTRINSIC
coiled coil region 1018 1046 N/A INTRINSIC
low complexity region 1137 1149 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele show decreased susceptibility to bacterial infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik T A 17: 33,066,518 I437F probably damaging Het
4930596D02Rik T A 14: 35,811,815 T45S probably benign Het
Ackr1 A G 1: 173,332,866 F29L probably benign Het
Adgrf2 T A 17: 42,714,414 S60C possibly damaging Het
Alpk2 A G 18: 65,349,873 C355R probably damaging Het
Ankmy1 A C 1: 92,885,191 D465E probably benign Het
Ankrd27 T A 7: 35,607,126 D310E probably damaging Het
Ap3d1 G A 10: 80,717,737 Q559* probably null Het
C4b T C 17: 34,732,978 T1298A probably damaging Het
Casr T A 16: 36,509,965 K336* probably null Het
Ccdc116 A T 16: 17,142,628 D108E probably benign Het
Ccr7 A T 11: 99,145,691 I135N possibly damaging Het
Cd96 A G 16: 46,118,001 Y34H possibly damaging Het
Cdan1 T A 2: 120,720,506 D1135V probably damaging Het
Cecr2 C A 6: 120,762,026 T1210K probably damaging Het
Cep152 C A 2: 125,566,254 A1390S probably benign Het
Chd9 T G 8: 91,022,790 probably null Het
Cntnap5c G T 17: 58,293,990 W776L probably benign Het
Col24a1 G A 3: 145,389,600 probably null Het
Cpa2 G T 6: 30,554,315 M311I probably damaging Het
Cpz A G 5: 35,506,743 F483L probably damaging Het
Ddx19a A C 8: 110,989,498 V90G probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fbxw7 A G 3: 84,969,171 D213G possibly damaging Het
Fgd2 T C 17: 29,369,299 F362L probably damaging Het
Fryl A G 5: 73,059,435 Y2171H probably damaging Het
Gba2 T C 4: 43,578,080 R90G probably benign Het
Gm10073 T C 8: 106,573,232 E40G probably damaging Het
Gm8251 T A 1: 44,059,227 I904F possibly damaging Het
Grhl3 T C 4: 135,552,550 I398V probably benign Het
Grip2 T A 6: 91,765,252 H899L probably damaging Het
Grk2 T C 19: 4,287,240 K644E possibly damaging Het
Iars A T 13: 49,711,775 T576S probably damaging Het
Kif26b G A 1: 178,932,139 V2084M probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lrrc69 G A 4: 14,775,079 T63M probably damaging Het
Lrrn4 A T 2: 132,869,966 C646S probably damaging Het
Mtf2 C T 5: 108,104,476 T457M probably damaging Het
Ncln A T 10: 81,487,721 C531S probably benign Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Olfr110 C T 17: 37,499,425 T258M possibly damaging Het
Olfr251 A T 9: 38,378,252 M124L possibly damaging Het
Olfr761 T C 17: 37,952,893 I44V probably benign Het
Otogl A G 10: 107,806,576 V1331A probably benign Het
Palb2 A G 7: 122,124,392 probably benign Het
Pcdh20 T C 14: 88,468,322 E514G possibly damaging Het
Pclaf A G 9: 65,890,448 N7S probably benign Het
Pdrg1 C T 2: 153,015,328 probably benign Het
Pik3r6 T A 11: 68,536,106 D464E probably benign Het
Pkp3 A G 7: 141,087,647 N454D probably damaging Het
Ppip5k1 A G 2: 121,337,182 V784A probably benign Het
Ppp1r36 T A 12: 76,436,254 D205E possibly damaging Het
Prss35 A T 9: 86,755,647 T157S probably benign Het
Ptprn2 T C 12: 117,161,709 L621P probably damaging Het
Rasgrp3 A G 17: 75,524,177 K524R probably damaging Het
Rasgrp4 T A 7: 29,140,263 H133Q probably benign Het
Reln A T 5: 21,929,086 Y2615N probably damaging Het
Rpf1 T A 3: 146,512,148 T204S probably benign Het
Scgb2b3 T A 7: 31,359,039 *113L probably null Het
Scn5a A C 9: 119,521,177 L877R possibly damaging Het
Sh3pxd2a A T 19: 47,268,382 D632E probably benign Het
Slc39a10 T C 1: 46,826,109 H522R probably damaging Het
Spink2 A T 5: 77,207,008 C19S probably damaging Het
Spsb4 A G 9: 96,996,213 L19P possibly damaging Het
St7l T C 3: 104,870,898 V117A probably damaging Het
Stac2 C T 11: 98,042,594 S174N probably damaging Het
Sult4a1 A G 15: 84,086,617 Y196H probably benign Het
Tex2 C T 11: 106,567,782 probably benign Het
Tprgl A T 4: 154,159,405 V98D possibly damaging Het
Ttn G A 2: 76,718,025 H31978Y probably damaging Het
Ttn T C 2: 76,828,509 probably benign Het
Tyk2 C A 9: 21,120,353 R447L probably damaging Het
Ucn3 T C 13: 3,941,634 Y6C possibly damaging Het
Urb1 A T 16: 90,788,082 probably null Het
Vmn2r94 G C 17: 18,244,144 A628G probably damaging Het
Wdr95 C A 5: 149,595,287 T389K probably damaging Het
Wrn A T 8: 33,280,766 probably null Het
Xab2 T A 8: 3,619,068 probably null Het
Zfp458 A T 13: 67,258,080 N95K possibly damaging Het
Zfp672 T C 11: 58,317,312 H61R probably damaging Het
Zfp942 C T 17: 21,928,439 G403E possibly damaging Het
Other mutations in Plekha7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Plekha7 APN 7 116135184 missense probably damaging 1.00
IGL01133:Plekha7 APN 7 116145241 splice site probably null
IGL01146:Plekha7 APN 7 116157473 splice site probably benign
IGL01307:Plekha7 APN 7 116145244 splice site probably benign
IGL02063:Plekha7 APN 7 116140701 missense possibly damaging 0.78
IGL02110:Plekha7 APN 7 116154628 splice site probably null
IGL02420:Plekha7 APN 7 116158234 missense probably damaging 1.00
IGL02660:Plekha7 APN 7 116157574 splice site probably benign
IGL02851:Plekha7 APN 7 116135178 missense probably damaging 1.00
R0066:Plekha7 UTSW 7 116157508 missense probably damaging 1.00
R0066:Plekha7 UTSW 7 116157508 missense probably damaging 1.00
R0130:Plekha7 UTSW 7 116170704 missense probably damaging 0.99
R0348:Plekha7 UTSW 7 116158020 missense probably damaging 1.00
R0595:Plekha7 UTSW 7 116144968 missense probably damaging 1.00
R0614:Plekha7 UTSW 7 116154645 nonsense probably null
R0732:Plekha7 UTSW 7 116145237 missense probably damaging 1.00
R1695:Plekha7 UTSW 7 116128685 missense probably damaging 1.00
R1794:Plekha7 UTSW 7 116140681 missense probably damaging 1.00
R1895:Plekha7 UTSW 7 116144974 missense probably damaging 1.00
R2153:Plekha7 UTSW 7 116175767 missense probably damaging 1.00
R3106:Plekha7 UTSW 7 116164404 missense probably benign 0.02
R3605:Plekha7 UTSW 7 116164242 missense possibly damaging 0.68
R3606:Plekha7 UTSW 7 116164242 missense possibly damaging 0.68
R3789:Plekha7 UTSW 7 116175734 missense probably damaging 1.00
R4584:Plekha7 UTSW 7 116237533 intron probably benign
R4750:Plekha7 UTSW 7 116137311 missense probably damaging 1.00
R4774:Plekha7 UTSW 7 116144943 missense probably damaging 1.00
R4810:Plekha7 UTSW 7 116144938 missense probably damaging 1.00
R4895:Plekha7 UTSW 7 116189391 unclassified probably null
R4925:Plekha7 UTSW 7 116158128 missense probably damaging 1.00
R5556:Plekha7 UTSW 7 116164149 missense probably benign 0.20
R5599:Plekha7 UTSW 7 116176882 splice site probably null
R5848:Plekha7 UTSW 7 116140399 missense probably damaging 1.00
R5928:Plekha7 UTSW 7 116128574 missense probably benign
R5941:Plekha7 UTSW 7 116124805 missense possibly damaging 0.56
R6351:Plekha7 UTSW 7 116176898 missense probably damaging 1.00
R6520:Plekha7 UTSW 7 116164482 missense probably benign 0.16
R6699:Plekha7 UTSW 7 116135175 missense probably damaging 1.00
R6781:Plekha7 UTSW 7 116157855 critical splice donor site probably null
R6843:Plekha7 UTSW 7 116143320 missense probably benign 0.45
R6977:Plekha7 UTSW 7 116135967 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCAAGTCCTTCGTTGAGCCCAGAG -3'
(R):5'- TCTGTGGCTAGGATGAGCCCAAAG -3'

Sequencing Primer
(F):5'- CCCACTCAGCGTGGAGAAAG -3'
(R):5'- ttgattgtcaacacctgtaatcc -3'
Posted On2014-05-09