Incidental Mutation 'R1681:Duoxa2'
ID188471
Institutional Source Beutler Lab
Gene Symbol Duoxa2
Ensembl Gene ENSMUSG00000027225
Gene Namedual oxidase maturation factor 2
Synonyms
MMRRC Submission 039717-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.303) question?
Stock #R1681 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location122298900-122302885 bp(+) (GRCm38)
Type of Mutationunclassified (3029 bp from exon)
DNA Base Change (assembly) T to C at 122299162 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000106167 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028653] [ENSMUST00000028656] [ENSMUST00000053734] [ENSMUST00000110537] [ENSMUST00000110538]
Predicted Effect probably null
Transcript: ENSMUST00000028653
SMART Domains Protein: ENSMUSP00000028653
Gene: ENSMUSG00000027224

DomainStartEndE-ValueType
Pfam:DuoxA 10 287 7.2e-115 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000028656
AA Change: I41T

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000028656
Gene: ENSMUSG00000027225
AA Change: I41T

DomainStartEndE-ValueType
Pfam:DuoxA 10 286 5.5e-114 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000053734
SMART Domains Protein: ENSMUSP00000050314
Gene: ENSMUSG00000068452

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:An_peroxidase 35 560 5e-131 PFAM
transmembrane domain 600 622 N/A INTRINSIC
EFh 823 851 3.7e-5 SMART
EFh 859 887 2.09e-4 SMART
transmembrane domain 1010 1032 N/A INTRINSIC
Pfam:Ferric_reduct 1053 1202 1.8e-22 PFAM
Pfam:FAD_binding_8 1238 1340 3.1e-20 PFAM
Pfam:NAD_binding_6 1346 1500 1.5e-33 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000110537
SMART Domains Protein: ENSMUSP00000106166
Gene: ENSMUSG00000027224

DomainStartEndE-ValueType
Pfam:DuoxA 9 290 3.9e-128 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000110538
SMART Domains Protein: ENSMUSP00000106167
Gene: ENSMUSG00000027224

DomainStartEndE-ValueType
Pfam:DuoxA 9 70 1.7e-23 PFAM
Pfam:DuoxA 67 245 2.4e-80 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155561
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an endoplasmic reticulum protein that is necessary for proper cellular localization and maturation of functional dual oxidase 2. Mutations in this gene have been associated with thyroid dyshormonogenesis 5.[provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a knock-out allele of Duoxa1 and 2 exhibit severe hypothyrodism with severe postnatal growth, delayed eye opening, enlarged thyroid, enlarged adenohypophysis, respiratory distress and death at weaning when weaned at 21 days. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T A 11: 84,226,185 I247N probably damaging Het
Ankle1 G T 8: 71,407,618 S260I probably benign Het
Aoc2 T C 11: 101,325,192 S34P probably benign Het
Ap1m1 A C 8: 72,256,122 I397L possibly damaging Het
Apba1 C A 19: 23,936,561 D649E probably damaging Het
Aptx C T 4: 40,697,274 V25M probably benign Het
Arhgef18 G A 8: 3,439,645 G326R probably damaging Het
Atm A C 9: 53,522,155 I265S possibly damaging Het
B3galt4 A T 17: 33,951,213 V17E probably benign Het
Bcl7a T A 5: 123,356,023 M86K possibly damaging Het
Cela3a T A 4: 137,402,684 probably null Het
Cep85 T A 4: 134,148,728 K456* probably null Het
Ces1f C A 8: 93,275,414 A29S probably benign Het
Chd9 A T 8: 90,973,135 I598F probably damaging Het
Cntln T C 4: 84,947,635 L176S probably damaging Het
Cntn3 A T 6: 102,170,668 N909K probably damaging Het
Cntnap5b T C 1: 100,076,107 S271P probably damaging Het
Col6a3 T A 1: 90,773,502 H2564L unknown Het
Cyp2b19 C A 7: 26,763,340 probably null Het
Dapk1 G T 13: 60,718,464 probably null Het
Dnah7b T A 1: 46,324,712 Y3497* probably null Het
Eny2 T C 15: 44,432,478 W42R probably damaging Het
Epha3 A G 16: 63,595,728 V635A probably damaging Het
Fam167b G C 4: 129,578,276 Q34E probably benign Het
Fam26f A G 10: 34,127,900 F4L probably benign Het
Fancm T C 12: 65,105,656 M962T probably benign Het
Gimap8 T A 6: 48,656,411 I388N probably benign Het
Gpaa1 A G 15: 76,331,453 T22A probably benign Het
Hoxc11 T C 15: 102,955,156 S211P possibly damaging Het
Hsd17b12 T C 2: 94,033,561 N312S unknown Het
Idh2 T G 7: 80,099,158 E125A probably damaging Het
Igdcc4 A G 9: 65,128,795 Y712C probably damaging Het
Kank1 T C 19: 25,410,304 V447A possibly damaging Het
Kif1b T A 4: 149,195,501 probably null Het
Klc4 A T 17: 46,636,770 D335E probably damaging Het
Klhl33 T A 14: 50,893,077 D320V probably benign Het
Krt73 A T 15: 101,802,047 M84K possibly damaging Het
Kti12 T A 4: 108,848,858 I323N probably damaging Het
Kynu T C 2: 43,679,825 L373P probably damaging Het
Lats1 T C 10: 7,705,914 M821T probably damaging Het
Lnx1 A T 5: 74,685,410 H126Q probably benign Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Lrrc4b T A 7: 44,461,177 Y158N probably damaging Het
Lrrc74b C A 16: 17,559,753 R87L probably damaging Het
Meig1 T C 2: 3,409,274 D63G probably damaging Het
Mrpl38 G A 11: 116,138,429 probably benign Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Nlrp1a T A 11: 71,142,358 E3D unknown Het
Nphs2 T A 1: 156,320,898 D110E probably damaging Het
Nxn T A 11: 76,272,464 K244N probably benign Het
Oas3 A T 5: 120,769,908 F322L probably benign Het
Obscn T A 11: 59,103,325 Y1577F probably damaging Het
Olfr1122 G A 2: 87,388,620 R305K possibly damaging Het
Olfr911-ps1 T A 9: 38,524,117 N128K probably benign Het
Olfr914 G A 9: 38,606,948 G161D probably damaging Het
Olfr917 A G 9: 38,665,320 Y175H probably benign Het
Olfr924 T C 9: 38,848,513 M133T probably damaging Het
Panx1 T C 9: 15,007,783 D260G probably benign Het
Pcdhb15 T C 18: 37,473,813 Y33H probably damaging Het
Pik3ap1 C A 19: 41,308,529 V461F probably damaging Het
Plpp3 G A 4: 105,208,805 probably null Het
Prtn3 A T 10: 79,880,541 T61S probably benign Het
Psen1 T A 12: 83,724,620 Y225N probably damaging Het
Rab44 T A 17: 29,140,124 S429T possibly damaging Het
Ralgapa1 T C 12: 55,762,603 I462M probably benign Het
Rbfox3 T C 11: 118,505,669 N105S probably damaging Het
Rbm7 A C 9: 48,489,721 Y236D possibly damaging Het
Samhd1 T C 2: 157,101,732 T621A probably benign Het
Samt3 C A X: 86,046,650 D49E probably benign Het
Sass6 T C 3: 116,603,473 V26A possibly damaging Het
Scn11a C T 9: 119,804,412 M418I possibly damaging Het
Scrib T C 15: 76,064,567 E480G probably damaging Het
Sec24a T G 11: 51,695,189 T1071P probably damaging Het
Siglecg A C 7: 43,408,941 E84A probably benign Het
Slc6a17 C T 3: 107,474,386 V419I probably damaging Het
Soga1 T C 2: 157,030,530 T966A possibly damaging Het
Ssr2 T C 3: 88,581,042 M75T possibly damaging Het
Tbc1d22b A G 17: 29,575,177 T275A possibly damaging Het
Tbx15 T A 3: 99,351,824 probably null Het
Tll1 A C 8: 64,085,551 L353R possibly damaging Het
Tlr4 C T 4: 66,841,105 P712S probably damaging Het
Tmem145 T A 7: 25,314,734 F424L possibly damaging Het
Tnrc18 T C 5: 142,773,817 K755E unknown Het
Trmt44 A G 5: 35,569,977 I298T probably benign Het
Vmn1r69 A G 7: 10,580,252 V184A probably benign Het
Zfp84 T C 7: 29,777,400 C506R probably damaging Het
Other mutations in Duoxa2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02067:Duoxa2 APN 2 122300591 missense possibly damaging 0.93
IGL02194:Duoxa2 APN 2 122301849 missense possibly damaging 0.92
R2186:Duoxa2 UTSW 2 122299174 missense probably damaging 1.00
R4062:Duoxa2 UTSW 2 122300577 missense probably damaging 1.00
R4064:Duoxa2 UTSW 2 122300577 missense probably damaging 1.00
R4757:Duoxa2 UTSW 2 122300591 missense possibly damaging 0.93
R4791:Duoxa2 UTSW 2 122301198 missense probably damaging 1.00
R5485:Duoxa2 UTSW 2 122299152 missense possibly damaging 0.82
R6025:Duoxa2 UTSW 2 122301851 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TGCTGCCCACGCTCCTATAAAAG -3'
(R):5'- GCATCTGCTGATCCTCGGAGAATC -3'

Sequencing Primer
(F):5'- TGTGAACACTGCGTGAAGTC -3'
(R):5'- GATCCTCGGAGAATCTTCCTTAG -3'
Posted On2014-05-09