Incidental Mutation 'R1750:Asap2'
ID193440
Institutional Source Beutler Lab
Gene Symbol Asap2
Ensembl Gene ENSMUSG00000052632
Gene NameArfGAP with SH3 domain, ankyrin repeat and PH domain 2
Synonyms6530401G17Rik, LOC385250, Ddef2
MMRRC Submission 039782-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.157) question?
Stock #R1750 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location20990459-21270171 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 21203998 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 170 (L170P)
Ref Sequence ENSEMBL: ENSMUSP00000063217 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050990] [ENSMUST00000064595] [ENSMUST00000090834] [ENSMUST00000101562]
Predicted Effect possibly damaging
Transcript: ENSMUST00000050990
AA Change: L170P

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000054631
Gene: ENSMUSG00000052632
AA Change: L170P

DomainStartEndE-ValueType
low complexity region 127 144 N/A INTRINSIC
low complexity region 154 166 N/A INTRINSIC
PH 306 399 2.31e-18 SMART
ArfGap 421 541 6.82e-27 SMART
ANK 584 616 6.17e-1 SMART
ANK 620 649 4.03e-5 SMART
ANK 653 683 1.48e3 SMART
low complexity region 693 707 N/A INTRINSIC
low complexity region 765 789 N/A INTRINSIC
low complexity region 827 847 N/A INTRINSIC
SH3 896 954 4.28e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000064595
AA Change: L170P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000063217
Gene: ENSMUSG00000052632
AA Change: L170P

DomainStartEndE-ValueType
Pfam:BAR 11 247 2.4e-9 PFAM
Pfam:BAR_3 31 265 3.3e-28 PFAM
PH 306 399 2.31e-18 SMART
ArfGap 421 541 6.82e-27 SMART
ANK 584 616 6.17e-1 SMART
ANK 620 649 4.03e-5 SMART
ANK 653 683 1.48e3 SMART
low complexity region 693 707 N/A INTRINSIC
low complexity region 765 789 N/A INTRINSIC
low complexity region 837 849 N/A INTRINSIC
low complexity region 872 892 N/A INTRINSIC
SH3 941 999 4.28e-16 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000090834
AA Change: L170P

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000088344
Gene: ENSMUSG00000052632
AA Change: L170P

DomainStartEndE-ValueType
low complexity region 127 144 N/A INTRINSIC
low complexity region 154 166 N/A INTRINSIC
Blast:PH 196 318 1e-50 BLAST
Blast:ArfGap 334 395 5e-30 BLAST
ANK 438 470 6.17e-1 SMART
ANK 474 503 4.03e-5 SMART
ANK 507 537 1.48e3 SMART
low complexity region 547 561 N/A INTRINSIC
low complexity region 619 643 N/A INTRINSIC
low complexity region 681 701 N/A INTRINSIC
SH3 750 808 4.28e-16 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000101562
AA Change: L170P

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000099098
Gene: ENSMUSG00000052632
AA Change: L170P

DomainStartEndE-ValueType
low complexity region 127 144 N/A INTRINSIC
low complexity region 154 166 N/A INTRINSIC
PH 309 402 2.31e-18 SMART
ArfGap 424 544 6.82e-27 SMART
ANK 587 619 6.17e-1 SMART
ANK 623 652 4.03e-5 SMART
ANK 656 686 1.48e3 SMART
low complexity region 696 710 N/A INTRINSIC
low complexity region 768 792 N/A INTRINSIC
low complexity region 830 850 N/A INTRINSIC
SH3 899 957 4.28e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174530
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.2%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multidomain protein containing an N-terminal alpha-helical region with a coiled-coil motif, followed by a pleckstrin homology (PH) domain, an Arf-GAP domain, an ankyrin homology region, a proline-rich region, and a C-terminal Src homology 3 (SH3) domain. The protein localizes in the Golgi apparatus and at the plasma membrane, where it colocalizes with protein tyrosine kinase 2-beta (PYK2). The encoded protein forms a stable complex with PYK2 in vivo. This interaction appears to be mediated by binding of its SH3 domain to the C-terminal proline-rich domain of PYK2. The encoded protein is tyrosine phosphorylated by activated PYK2. It has catalytic activity for class I and II ArfGAPs in vitro, and can bind the class III Arf ARF6 without immediate GAP activity. The encoded protein is believed to function as an ARF GAP that controls ARF-mediated vesicle budding when recruited to Golgi membranes. In addition, it functions as a substrate and downstream target for PYK2 and SRC, a pathway that may be involved in the regulation of vesicular transport. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2008]
Allele List at MGI
Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933402N03Rik G T 7: 131,146,130 N44K probably benign Het
Acd C A 8: 105,698,892 A270S possibly damaging Het
Acnat1 G A 4: 49,451,042 T23I probably benign Het
Adam26a T G 8: 43,570,189 E88A possibly damaging Het
Adgrb1 G A 15: 74,541,827 V589M probably benign Het
Agbl2 T A 2: 90,816,376 probably benign Het
Aif1 G A 17: 35,172,151 P44L probably benign Het
Amh AGCGCCTTGG AG 10: 80,805,585 probably null Het
Btg2 T C 1: 134,079,031 D8G probably benign Het
C530008M17Rik A G 5: 76,857,675 I628V unknown Het
Cacna1g A T 11: 94,443,292 V841E probably damaging Het
Cacna2d1 C T 5: 16,264,288 P230L probably benign Het
Cacna2d2 A T 9: 107,524,644 D766V probably damaging Het
Carns1 A G 19: 4,173,157 W23R possibly damaging Het
Cdk11b T A 4: 155,628,680 probably null Het
Chrna3 T C 9: 55,016,057 S156G probably damaging Het
Cmya5 A T 13: 93,095,663 N972K probably benign Het
Cpne7 C A 8: 123,134,524 P541T probably damaging Het
Csmd1 A T 8: 15,917,303 L3187I probably damaging Het
Dbt A G 3: 116,546,294 I404V probably benign Het
Dgki A T 6: 36,916,434 I819K probably damaging Het
Dip2b T A 15: 100,178,466 S782T probably benign Het
Dlc1 A T 8: 36,858,090 probably null Het
Dnajc13 A T 9: 104,221,477 V459E probably damaging Het
Enam A G 5: 88,503,227 E790G probably damaging Het
Epb41l4a G C 18: 33,828,208 Y424* probably null Het
Extl1 A G 4: 134,362,688 S370P probably benign Het
Fan1 T C 7: 64,373,013 Y164C probably benign Het
Fbxw15 G A 9: 109,558,246 S227F probably damaging Het
Fbxw25 A T 9: 109,650,073 I370N probably benign Het
Fcgbp T A 7: 28,093,443 Y957* probably null Het
Gkap1 C A 13: 58,237,043 E77* probably null Het
Gkn1 A T 6: 87,349,123 N28K unknown Het
Gls2 A G 10: 128,201,325 E245G probably damaging Het
Glyat G A 19: 12,646,315 V32I probably benign Het
Gm2431 A T 7: 142,258,025 C47* probably null Het
Gm5431 T C 11: 48,894,831 D239G probably benign Het
Gm9573 T A 17: 35,621,048 probably benign Het
Inpp5d T C 1: 87,699,081 F540L probably damaging Het
Kcna1 A C 6: 126,642,808 I183S probably benign Het
Kpna2 G T 11: 106,991,445 L212I probably damaging Het
Krt36 C G 11: 100,104,058 R229S probably benign Het
Krt78 G A 15: 101,946,377 H1000Y probably benign Het
Krt90 A G 15: 101,553,365 probably benign Het
Ldlrad4 C A 18: 68,106,687 F59L probably benign Het
Lrrc3b T C 14: 15,358,601 N2D probably benign Het
Madd T C 2: 91,167,891 D239G probably damaging Het
Mapk8ip3 C T 17: 24,914,459 G332S probably null Het
Mastl A T 2: 23,146,081 L141* probably null Het
Mdh1b T C 1: 63,719,522 N304D probably benign Het
Mfsd4b3 G T 10: 39,947,933 N110K probably benign Het
Mtus2 T C 5: 148,277,633 S1035P probably damaging Het
Myh11 T A 16: 14,200,758 D1908V probably damaging Het
Myh11 T C 16: 14,215,790 E1080G probably damaging Het
Mypn A C 10: 63,136,197 M688R probably benign Het
Nat8l G T 5: 34,000,786 C180F probably damaging Het
Nip7 T A 8: 107,057,386 L86Q probably damaging Het
Nisch C T 14: 31,174,882 probably benign Het
Nop2 A G 6: 125,137,638 I283V probably benign Het
Oas1h T A 5: 120,871,777 probably null Het
Olfr1118 T C 2: 87,308,852 V41A probably benign Het
Olfr1141 T A 2: 87,753,186 D269V probably damaging Het
Olfr117 A C 17: 37,659,673 I220S probably damaging Het
Olfr1188 C A 2: 88,560,058 D185E possibly damaging Het
Olfr1199 T C 2: 88,755,773 R301G probably benign Het
Olfr504 A T 7: 108,565,357 L146* probably null Het
Olfr901 T A 9: 38,430,690 M136K probably damaging Het
P4hb A G 11: 120,562,720 V373A probably damaging Het
Pappa2 C A 1: 158,763,150 E1645* probably null Het
Pcdh10 G T 3: 45,381,881 E877* probably null Het
Pcdhb17 C T 18: 37,485,711 R185C probably damaging Het
Pcdhb17 A G 18: 37,487,017 H620R possibly damaging Het
Pdcl3 T A 1: 38,995,865 F168I probably damaging Het
Pde4a T A 9: 21,203,232 I365N probably damaging Het
Pdzd2 A G 15: 12,385,864 V940A probably damaging Het
Picalm T A 7: 90,191,182 S399T possibly damaging Het
Pigk A T 3: 152,744,464 I249F probably damaging Het
Plxnb1 C A 9: 109,111,768 H1570Q probably benign Het
Plxnc1 A G 10: 94,799,497 Y1321H probably damaging Het
Ppm1g G A 5: 31,206,216 S114F probably damaging Het
Rassf4 A G 6: 116,640,267 M259T probably damaging Het
Rbm47 T C 5: 66,019,310 K557E possibly damaging Het
Rhobtb1 A G 10: 69,279,406 K21R probably damaging Het
Selenoi T C 5: 30,257,773 F212S probably benign Het
Shc3 T G 13: 51,449,292 Y259S probably damaging Het
Slc11a2 T C 15: 100,401,287 N134S probably damaging Het
Slc9a7 A T X: 20,162,478 M368K probably damaging Het
Slx4ip T A 2: 137,046,749 C117S probably damaging Het
Spata31d1d T A 13: 59,728,695 Q342L probably benign Het
Spink13 T A 18: 62,607,749 Y93F probably damaging Het
St6galnac5 A T 3: 152,846,321 I203N possibly damaging Het
Syne2 T A 12: 76,052,805 C5335S probably damaging Het
Tagap T A 17: 7,929,910 D173E probably benign Het
Tekt3 A C 11: 63,070,041 Y12S probably damaging Het
Tmem81 T A 1: 132,507,583 N42K probably damaging Het
Tnc A G 4: 63,972,735 W1728R probably damaging Het
Ttc30a1 C T 2: 75,980,255 V495I probably benign Het
Ttc33 C T 15: 5,212,098 R135* probably null Het
Ttc37 T A 13: 76,140,601 L951Q possibly damaging Het
Unc5c A G 3: 141,827,517 D842G possibly damaging Het
Usp43 A T 11: 67,879,953 H618Q probably damaging Het
Vmn2r50 T G 7: 10,052,988 N64T possibly damaging Het
Vmn2r53 T C 7: 12,581,705 Y729C probably damaging Het
Vmn2r59 T A 7: 42,045,827 H387L possibly damaging Het
Vstm2a G T 11: 16,263,166 V184F possibly damaging Het
Wdr53 T G 16: 32,252,117 N93K probably damaging Het
Wdr95 A G 5: 149,581,886 probably null Het
Xpot A T 10: 121,603,027 probably null Het
Xrcc5 C T 1: 72,325,087 Q233* probably null Het
Zbtb18 T A 1: 177,447,511 C137S possibly damaging Het
Zfp58 C A 13: 67,491,479 G298* probably null Het
Zfp963 A G 8: 69,743,450 S118P possibly damaging Het
Zmynd15 A T 11: 70,462,567 Q336L probably benign Het
Other mutations in Asap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00791:Asap2 APN 12 21239648 missense possibly damaging 0.66
IGL01140:Asap2 APN 12 21206316 missense probably damaging 1.00
IGL01285:Asap2 APN 12 21229263 missense probably damaging 1.00
IGL01318:Asap2 APN 12 21247295 missense probably null 0.00
IGL01355:Asap2 APN 12 21218086 splice site probably benign
IGL01593:Asap2 APN 12 21213202 missense probably null 0.03
IGL01705:Asap2 APN 12 21249368 missense possibly damaging 0.85
IGL01716:Asap2 APN 12 21254306 missense possibly damaging 0.94
IGL02822:Asap2 APN 12 21265910 missense probably damaging 1.00
IGL02876:Asap2 APN 12 21258163 missense probably benign 0.00
IGL02991:Asap2 APN 12 21249293 splice site probably benign
R0157:Asap2 UTSW 12 21206325 missense probably damaging 1.00
R0399:Asap2 UTSW 12 21217997 missense possibly damaging 0.90
R0472:Asap2 UTSW 12 21213185 missense possibly damaging 0.47
R0959:Asap2 UTSW 12 21247319 missense probably damaging 1.00
R0981:Asap2 UTSW 12 21265960 missense probably damaging 0.98
R1141:Asap2 UTSW 12 21185110 missense probably damaging 1.00
R1382:Asap2 UTSW 12 21265954 missense probably damaging 1.00
R1418:Asap2 UTSW 12 21239585 missense probably damaging 1.00
R1418:Asap2 UTSW 12 21239589 missense probably damaging 1.00
R1469:Asap2 UTSW 12 21213179 missense probably benign 0.00
R1469:Asap2 UTSW 12 21213179 missense probably benign 0.00
R1526:Asap2 UTSW 12 21185187 missense probably damaging 1.00
R1542:Asap2 UTSW 12 21265997 missense probably damaging 1.00
R1710:Asap2 UTSW 12 21224392 missense probably damaging 1.00
R2151:Asap2 UTSW 12 21112083 missense probably damaging 1.00
R2152:Asap2 UTSW 12 21112083 missense probably damaging 1.00
R2154:Asap2 UTSW 12 21112083 missense probably damaging 1.00
R2323:Asap2 UTSW 12 21203968 missense probably damaging 1.00
R2378:Asap2 UTSW 12 21254318 missense possibly damaging 0.95
R3151:Asap2 UTSW 12 21224377 missense probably damaging 1.00
R3757:Asap2 UTSW 12 21267766 missense probably damaging 1.00
R4305:Asap2 UTSW 12 21229481 missense probably damaging 1.00
R4307:Asap2 UTSW 12 21229481 missense probably damaging 1.00
R4308:Asap2 UTSW 12 21229481 missense probably damaging 1.00
R4345:Asap2 UTSW 12 21230831 missense probably damaging 1.00
R4525:Asap2 UTSW 12 21229292 splice site probably null
R4562:Asap2 UTSW 12 21112093 missense probably damaging 1.00
R4999:Asap2 UTSW 12 21252765 missense probably benign 0.19
R5027:Asap2 UTSW 12 21204081 missense probably damaging 1.00
R5221:Asap2 UTSW 12 21213190 missense probably benign 0.14
R5645:Asap2 UTSW 12 21265982 missense probably damaging 0.99
R5799:Asap2 UTSW 12 21168246 missense probably damaging 1.00
R5876:Asap2 UTSW 12 21212809 missense possibly damaging 0.88
R5888:Asap2 UTSW 12 21218190 missense probably damaging 1.00
R5912:Asap2 UTSW 12 21206343 missense probably damaging 1.00
R6576:Asap2 UTSW 12 21244703 missense probably damaging 1.00
R6896:Asap2 UTSW 12 21265525 missense probably damaging 1.00
R6934:Asap2 UTSW 12 21168250 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAAAGAGCGTGGCGAGTGTTTATC -3'
(R):5'- GCCACACGCCAGTAAGTAGTCTAAC -3'

Sequencing Primer
(F):5'- GGCCTCTTGATTAATCCCTGCT -3'
(R):5'- GCCAGTAAGTAGTCTAACATTCCTC -3'
Posted On2014-05-23