Incidental Mutation 'R1750:Gm5431'
ID193431
Institutional Source Beutler Lab
Gene Symbol Gm5431
Ensembl Gene ENSMUSG00000058163
Gene Namepredicted gene 5431
Synonyms
MMRRC Submission 039782-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.028) question?
Stock #R1750 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location48887422-48902214 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 48894831 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 239 (D239G)
Ref Sequence ENSEMBL: ENSMUSP00000104835 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109209] [ENSMUST00000109210] [ENSMUST00000109212]
Predicted Effect probably benign
Transcript: ENSMUST00000109209
SMART Domains Protein: ENSMUSP00000104832
Gene: ENSMUSG00000058163

DomainStartEndE-ValueType
Pfam:IIGP 1 120 1.6e-22 PFAM
low complexity region 153 166 N/A INTRINSIC
Pfam:IIGP 169 542 9.4e-154 PFAM
Pfam:MMR_HSR1 205 359 1.5e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109210
SMART Domains Protein: ENSMUSP00000104833
Gene: ENSMUSG00000058163

DomainStartEndE-ValueType
Pfam:IIGP 1 120 1.6e-22 PFAM
low complexity region 153 166 N/A INTRINSIC
Pfam:IIGP 169 542 9.4e-154 PFAM
Pfam:MMR_HSR1 205 359 1.5e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109212
AA Change: D239G

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000104835
Gene: ENSMUSG00000058163
AA Change: D239G

DomainStartEndE-ValueType
Pfam:IIGP 36 398 2.5e-125 PFAM
Pfam:DLIC 54 107 3.4e-5 PFAM
Pfam:MMR_HSR1 72 235 1.7e-11 PFAM
low complexity region 431 444 N/A INTRINSIC
Pfam:IIGP 447 820 6.3e-153 PFAM
Pfam:MMR_HSR1 483 606 2.4e-7 PFAM
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.2%
  • 20x: 91.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933402N03Rik G T 7: 131,146,130 N44K probably benign Het
Acd C A 8: 105,698,892 A270S possibly damaging Het
Acnat1 G A 4: 49,451,042 T23I probably benign Het
Adam26a T G 8: 43,570,189 E88A possibly damaging Het
Adgrb1 G A 15: 74,541,827 V589M probably benign Het
Agbl2 T A 2: 90,816,376 probably benign Het
Aif1 G A 17: 35,172,151 P44L probably benign Het
Amh AGCGCCTTGG AG 10: 80,805,585 probably null Het
Asap2 T C 12: 21,203,998 L170P probably damaging Het
Btg2 T C 1: 134,079,031 D8G probably benign Het
C530008M17Rik A G 5: 76,857,675 I628V unknown Het
Cacna1g A T 11: 94,443,292 V841E probably damaging Het
Cacna2d1 C T 5: 16,264,288 P230L probably benign Het
Cacna2d2 A T 9: 107,524,644 D766V probably damaging Het
Carns1 A G 19: 4,173,157 W23R possibly damaging Het
Cdk11b T A 4: 155,628,680 probably null Het
Chrna3 T C 9: 55,016,057 S156G probably damaging Het
Cmya5 A T 13: 93,095,663 N972K probably benign Het
Cpne7 C A 8: 123,134,524 P541T probably damaging Het
Csmd1 A T 8: 15,917,303 L3187I probably damaging Het
Dbt A G 3: 116,546,294 I404V probably benign Het
Dgki A T 6: 36,916,434 I819K probably damaging Het
Dip2b T A 15: 100,178,466 S782T probably benign Het
Dlc1 A T 8: 36,858,090 probably null Het
Dnajc13 A T 9: 104,221,477 V459E probably damaging Het
Enam A G 5: 88,503,227 E790G probably damaging Het
Epb41l4a G C 18: 33,828,208 Y424* probably null Het
Extl1 A G 4: 134,362,688 S370P probably benign Het
Fan1 T C 7: 64,373,013 Y164C probably benign Het
Fbxw15 G A 9: 109,558,246 S227F probably damaging Het
Fbxw25 A T 9: 109,650,073 I370N probably benign Het
Fcgbp T A 7: 28,093,443 Y957* probably null Het
Gkap1 C A 13: 58,237,043 E77* probably null Het
Gkn1 A T 6: 87,349,123 N28K unknown Het
Gls2 A G 10: 128,201,325 E245G probably damaging Het
Glyat G A 19: 12,646,315 V32I probably benign Het
Gm2431 A T 7: 142,258,025 C47* probably null Het
Gm9573 T A 17: 35,621,048 probably benign Het
Inpp5d T C 1: 87,699,081 F540L probably damaging Het
Kcna1 A C 6: 126,642,808 I183S probably benign Het
Kpna2 G T 11: 106,991,445 L212I probably damaging Het
Krt36 C G 11: 100,104,058 R229S probably benign Het
Krt78 G A 15: 101,946,377 H1000Y probably benign Het
Krt90 A G 15: 101,553,365 probably benign Het
Ldlrad4 C A 18: 68,106,687 F59L probably benign Het
Lrrc3b T C 14: 15,358,601 N2D probably benign Het
Madd T C 2: 91,167,891 D239G probably damaging Het
Mapk8ip3 C T 17: 24,914,459 G332S probably null Het
Mastl A T 2: 23,146,081 L141* probably null Het
Mdh1b T C 1: 63,719,522 N304D probably benign Het
Mfsd4b3 G T 10: 39,947,933 N110K probably benign Het
Mtus2 T C 5: 148,277,633 S1035P probably damaging Het
Myh11 T A 16: 14,200,758 D1908V probably damaging Het
Myh11 T C 16: 14,215,790 E1080G probably damaging Het
Mypn A C 10: 63,136,197 M688R probably benign Het
Nat8l G T 5: 34,000,786 C180F probably damaging Het
Nip7 T A 8: 107,057,386 L86Q probably damaging Het
Nisch C T 14: 31,174,882 probably benign Het
Nop2 A G 6: 125,137,638 I283V probably benign Het
Oas1h T A 5: 120,871,777 probably null Het
Olfr1118 T C 2: 87,308,852 V41A probably benign Het
Olfr1141 T A 2: 87,753,186 D269V probably damaging Het
Olfr117 A C 17: 37,659,673 I220S probably damaging Het
Olfr1188 C A 2: 88,560,058 D185E possibly damaging Het
Olfr1199 T C 2: 88,755,773 R301G probably benign Het
Olfr504 A T 7: 108,565,357 L146* probably null Het
Olfr901 T A 9: 38,430,690 M136K probably damaging Het
P4hb A G 11: 120,562,720 V373A probably damaging Het
Pappa2 C A 1: 158,763,150 E1645* probably null Het
Pcdh10 G T 3: 45,381,881 E877* probably null Het
Pcdhb17 C T 18: 37,485,711 R185C probably damaging Het
Pcdhb17 A G 18: 37,487,017 H620R possibly damaging Het
Pdcl3 T A 1: 38,995,865 F168I probably damaging Het
Pde4a T A 9: 21,203,232 I365N probably damaging Het
Pdzd2 A G 15: 12,385,864 V940A probably damaging Het
Picalm T A 7: 90,191,182 S399T possibly damaging Het
Pigk A T 3: 152,744,464 I249F probably damaging Het
Plxnb1 C A 9: 109,111,768 H1570Q probably benign Het
Plxnc1 A G 10: 94,799,497 Y1321H probably damaging Het
Ppm1g G A 5: 31,206,216 S114F probably damaging Het
Rassf4 A G 6: 116,640,267 M259T probably damaging Het
Rbm47 T C 5: 66,019,310 K557E possibly damaging Het
Rhobtb1 A G 10: 69,279,406 K21R probably damaging Het
Selenoi T C 5: 30,257,773 F212S probably benign Het
Shc3 T G 13: 51,449,292 Y259S probably damaging Het
Slc11a2 T C 15: 100,401,287 N134S probably damaging Het
Slc9a7 A T X: 20,162,478 M368K probably damaging Het
Slx4ip T A 2: 137,046,749 C117S probably damaging Het
Spata31d1d T A 13: 59,728,695 Q342L probably benign Het
Spink13 T A 18: 62,607,749 Y93F probably damaging Het
St6galnac5 A T 3: 152,846,321 I203N possibly damaging Het
Syne2 T A 12: 76,052,805 C5335S probably damaging Het
Tagap T A 17: 7,929,910 D173E probably benign Het
Tekt3 A C 11: 63,070,041 Y12S probably damaging Het
Tmem81 T A 1: 132,507,583 N42K probably damaging Het
Tnc A G 4: 63,972,735 W1728R probably damaging Het
Ttc30a1 C T 2: 75,980,255 V495I probably benign Het
Ttc33 C T 15: 5,212,098 R135* probably null Het
Ttc37 T A 13: 76,140,601 L951Q possibly damaging Het
Unc5c A G 3: 141,827,517 D842G possibly damaging Het
Usp43 A T 11: 67,879,953 H618Q probably damaging Het
Vmn2r50 T G 7: 10,052,988 N64T possibly damaging Het
Vmn2r53 T C 7: 12,581,705 Y729C probably damaging Het
Vmn2r59 T A 7: 42,045,827 H387L possibly damaging Het
Vstm2a G T 11: 16,263,166 V184F possibly damaging Het
Wdr53 T G 16: 32,252,117 N93K probably damaging Het
Wdr95 A G 5: 149,581,886 probably null Het
Xpot A T 10: 121,603,027 probably null Het
Xrcc5 C T 1: 72,325,087 Q233* probably null Het
Zbtb18 T A 1: 177,447,511 C137S possibly damaging Het
Zfp58 C A 13: 67,491,479 G298* probably null Het
Zfp963 A G 8: 69,743,450 S118P possibly damaging Het
Zmynd15 A T 11: 70,462,567 Q336L probably benign Het
Other mutations in Gm5431
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Gm5431 APN 11 48895414 missense probably benign 0.09
IGL00964:Gm5431 APN 11 48889267 missense probably damaging 0.99
IGL01571:Gm5431 APN 11 48894713 missense probably benign 0.00
IGL02006:Gm5431 APN 11 48888503 missense probably damaging 1.00
IGL02084:Gm5431 APN 11 48889085 missense probably benign 0.41
IGL02255:Gm5431 APN 11 48888958 missense possibly damaging 0.93
IGL02291:Gm5431 APN 11 48888964 missense probably damaging 1.00
IGL03194:Gm5431 APN 11 48895537 intron probably benign
IGL03251:Gm5431 APN 11 48894721 missense probably benign 0.00
R1168:Gm5431 UTSW 11 48895364 missense probably benign 0.36
R1387:Gm5431 UTSW 11 48895015 missense possibly damaging 0.92
R1396:Gm5431 UTSW 11 48895434 intron probably benign
R1711:Gm5431 UTSW 11 48895026 missense possibly damaging 0.73
R1927:Gm5431 UTSW 11 48889255 missense probably damaging 1.00
R1957:Gm5431 UTSW 11 48888397 nonsense probably null
R2196:Gm5431 UTSW 11 48889231 missense probably damaging 1.00
R2509:Gm5431 UTSW 11 48888709 missense probably benign 0.16
R2511:Gm5431 UTSW 11 48888709 missense probably benign 0.16
R4018:Gm5431 UTSW 11 48889168 missense probably damaging 1.00
R4859:Gm5431 UTSW 11 48889582 missense probably damaging 1.00
R4895:Gm5431 UTSW 11 48889028 missense probably damaging 0.98
R5124:Gm5431 UTSW 11 48889039 missense probably benign 0.31
R5311:Gm5431 UTSW 11 48888889 missense probably damaging 1.00
R5600:Gm5431 UTSW 11 48894756 missense possibly damaging 0.56
R5728:Gm5431 UTSW 11 48888613 missense probably damaging 1.00
R5731:Gm5431 UTSW 11 48894448 missense probably damaging 0.96
R6120:Gm5431 UTSW 11 48894781 missense probably benign 0.36
R6129:Gm5431 UTSW 11 48889591 missense probably damaging 1.00
R6169:Gm5431 UTSW 11 48888575 missense probably benign 0.29
R6192:Gm5431 UTSW 11 48894393 missense probably benign 0.01
R6253:Gm5431 UTSW 11 48894999 missense probably benign 0.00
R6326:Gm5431 UTSW 11 48889345 missense probably damaging 1.00
R6401:Gm5431 UTSW 11 48888709 missense probably benign 0.16
R6654:Gm5431 UTSW 11 48894600 missense possibly damaging 0.91
R6810:Gm5431 UTSW 11 48888976 missense probably damaging 1.00
R6965:Gm5431 UTSW 11 48895200 missense probably benign 0.19
R6970:Gm5431 UTSW 11 48888490 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCAGCGATGTTTTCCAGTGATGCC -3'
(R):5'- TAATGACGCAGAGCTTGCCAAAGCC -3'

Sequencing Primer
(F):5'- GGCCAAAGGAAGATCTATAGTCATTC -3'
(R):5'- AGCTTGCCAAAGCCATTGTG -3'
Posted On2014-05-23