Incidental Mutation 'R1806:Hook3'
ID203469
Institutional Source Beutler Lab
Gene Symbol Hook3
Ensembl Gene ENSMUSG00000037234
Gene Namehook microtubule tethering protein 3
SynonymsE330005F07Rik, 5830454D03Rik
MMRRC Submission 039835-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.376) question?
Stock #R1806 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location26021421-26119224 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 26068659 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 59 (L59Q)
Ref Sequence ENSEMBL: ENSMUSP00000115008 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037182] [ENSMUST00000147613]
Predicted Effect possibly damaging
Transcript: ENSMUST00000037182
AA Change: L378Q

PolyPhen 2 Score 0.547 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000046788
Gene: ENSMUSG00000037234
AA Change: L378Q

DomainStartEndE-ValueType
Pfam:HOOK 12 710 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000147613
AA Change: L59Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115008
Gene: ENSMUSG00000037234
AA Change: L59Q

DomainStartEndE-ValueType
Pfam:HOOK 1 194 1.1e-75 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209996
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210172
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210389
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210860
Meta Mutation Damage Score 0.434 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.8%
  • 10x: 94.9%
  • 20x: 91.2%
Validation Efficiency 96% (77/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Hook proteins are cytosolic coiled-coil proteins that contain conserved N-terminal domains, which attach to microtubules, and more divergent C-terminal domains, which mediate binding to organelles. The Drosophila Hook protein is a component of the endocytic compartment.[supplied by OMIM, Apr 2004]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8430408G22Rik G A 6: 116,651,722 V9M possibly damaging Het
Adamts15 C A 9: 30,904,815 C616F probably damaging Het
Adarb1 T C 10: 77,322,265 N116S probably damaging Het
Add2 C T 6: 86,118,657 S437L probably damaging Het
Adra1d T A 2: 131,546,149 R495S probably benign Het
Agk C T 6: 40,387,495 T309I probably damaging Het
Aqr T C 2: 114,161,652 Y81C probably damaging Het
Bak1 G A 17: 27,021,268 Q142* probably null Het
Bckdha A G 7: 25,631,420 V307A probably damaging Het
Camk2n2 C A 16: 20,620,198 G72V probably benign Het
Cd276 A T 9: 58,527,562 probably benign Het
Cd2ap G A 17: 42,838,758 Q122* probably null Het
Cdan1 T A 2: 120,731,426 probably benign Het
Cdh3 T C 8: 106,536,915 S156P probably benign Het
Chil4 T A 3: 106,210,643 probably benign Het
Col11a1 C T 3: 114,158,142 R1074C probably damaging Het
Fcrlb T C 1: 170,907,527 T344A probably benign Het
Fras1 T A 5: 96,713,970 probably benign Het
Fras1 G T 5: 96,764,976 V3380F possibly damaging Het
Galnt9 A G 5: 110,619,253 D530G possibly damaging Het
Gja10 A T 4: 32,601,135 S416R probably benign Het
Gm10549 T A 18: 33,470,788 V108E unknown Het
Gm8298 T C 3: 59,877,150 L348P probably damaging Het
Hpf1 T A 8: 60,900,120 D178E probably benign Het
Hsd17b7 T C 1: 169,961,129 N173S possibly damaging Het
Hsph1 A G 5: 149,629,989 F236L probably damaging Het
Kcnk12 G T 17: 87,746,109 T375K probably benign Het
Kdelc2 T C 9: 53,395,850 Y365H probably damaging Het
Klra3 A T 6: 130,327,070 S220T probably damaging Het
Lhx1 A T 11: 84,524,141 L12Q probably damaging Het
Lnx1 A G 5: 74,606,049 L468P probably damaging Het
Ltbp3 T A 19: 5,753,942 C827* probably null Het
Mical1 C T 10: 41,478,214 A53V probably damaging Het
Mmp10 A T 9: 7,506,501 H326L probably benign Het
Mpl A T 4: 118,443,532 M600K possibly damaging Het
Muc5b T A 7: 141,865,493 D4004E possibly damaging Het
Myo5b A T 18: 74,577,609 H98L possibly damaging Het
Nbeal1 A G 1: 60,284,092 T2110A probably damaging Het
Nedd4l C A 18: 65,212,791 R825S probably damaging Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Olfr1277 A T 2: 111,270,277 I30N possibly damaging Het
Olfr228 A T 2: 86,483,139 I201N probably damaging Het
Olfr596 T A 7: 103,310,225 L168Q probably damaging Het
Otog A T 7: 46,290,937 probably null Het
Parp2 T A 14: 50,819,379 L320H probably damaging Het
Pola2 C T 19: 5,943,222 probably null Het
Poln A T 5: 34,107,150 probably benign Het
Pomt1 T A 2: 32,241,668 V123E probably damaging Het
Prom2 T C 2: 127,532,882 Y578C probably damaging Het
Prss23 T C 7: 89,510,391 T157A probably damaging Het
Sdk1 T A 5: 141,613,195 V205E probably damaging Het
Sdk1 A G 5: 142,161,926 K1771R probably benign Het
Sidt1 A T 16: 44,281,871 S309T possibly damaging Het
Sirpa T A 2: 129,615,512 F169I probably damaging Het
Slc8a1 T C 17: 81,648,487 N374S probably damaging Het
Sp110 C T 1: 85,596,110 probably null Het
Stard9 A G 2: 120,679,453 probably null Het
Synpr A G 14: 13,563,082 N105S probably damaging Het
Tbc1d16 T C 11: 119,156,101 Y440C probably damaging Het
Trabd A G 15: 89,085,621 I313V possibly damaging Het
Trappc10 T C 10: 78,210,776 R430G probably damaging Het
Trim50 A G 5: 135,358,889 E145G probably benign Het
Uba2 A T 7: 34,163,199 F105I probably damaging Het
Uba3 A G 6: 97,199,269 V92A possibly damaging Het
Uhmk1 T C 1: 170,211,059 K153R probably damaging Het
Vmn2r3 T A 3: 64,275,472 M269L probably benign Het
Vmn2r3 T C 3: 64,287,389 K8R possibly damaging Het
Xpot G T 10: 121,607,638 probably benign Het
Zfp128 A G 7: 12,891,022 Y439C probably benign Het
Zfy1 T A Y: 725,620 H715L possibly damaging Het
Zmym1 A C 4: 127,048,079 L839V probably damaging Het
Other mutations in Hook3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00695:Hook3 APN 8 26059250 missense possibly damaging 0.46
IGL01066:Hook3 APN 8 26048298 missense probably damaging 1.00
IGL01145:Hook3 APN 8 26059344 missense probably benign 0.00
IGL01514:Hook3 APN 8 26088189 missense possibly damaging 0.69
IGL01727:Hook3 APN 8 26070159 missense probably benign 0.00
IGL01832:Hook3 APN 8 26072365 missense possibly damaging 0.87
IGL01874:Hook3 APN 8 26039732 missense possibly damaging 0.71
IGL01931:Hook3 APN 8 26088055 splice site probably benign
IGL01948:Hook3 APN 8 26059312 missense possibly damaging 0.95
IGL02209:Hook3 APN 8 26070265 missense probably damaging 0.99
IGL02675:Hook3 APN 8 26061434 missense possibly damaging 0.64
IGL02750:Hook3 APN 8 26095754 splice site probably benign
Rufio UTSW 8 26034940 nonsense probably null
R0384:Hook3 UTSW 8 26044235 splice site probably null
R0600:Hook3 UTSW 8 26118986 missense probably benign
R1037:Hook3 UTSW 8 26072350 missense possibly damaging 0.92
R1413:Hook3 UTSW 8 26038106 missense probably damaging 0.98
R1563:Hook3 UTSW 8 26110752 missense probably benign 0.06
R1767:Hook3 UTSW 8 26071056 critical splice donor site probably null
R2025:Hook3 UTSW 8 26038098 missense probably damaging 0.96
R2026:Hook3 UTSW 8 26038098 missense probably damaging 0.96
R2027:Hook3 UTSW 8 26038098 missense probably damaging 0.96
R2091:Hook3 UTSW 8 26059394 splice site probably benign
R2153:Hook3 UTSW 8 26070197 missense probably damaging 1.00
R2184:Hook3 UTSW 8 26118983 missense probably benign 0.00
R4586:Hook3 UTSW 8 26032011 missense probably damaging 0.98
R4863:Hook3 UTSW 8 26038029 missense probably damaging 1.00
R4971:Hook3 UTSW 8 26082579 missense probably benign 0.22
R5023:Hook3 UTSW 8 26032019 frame shift probably null
R5026:Hook3 UTSW 8 26110757 missense probably damaging 0.98
R5068:Hook3 UTSW 8 26095757 critical splice donor site probably null
R5253:Hook3 UTSW 8 26072291 missense probably benign
R5383:Hook3 UTSW 8 26118989 missense probably benign 0.01
R5437:Hook3 UTSW 8 26061422 missense probably benign 0.05
R5528:Hook3 UTSW 8 26072293 missense probably damaging 1.00
R5551:Hook3 UTSW 8 26068611 missense possibly damaging 0.75
R5846:Hook3 UTSW 8 26044327 intron probably benign
R5907:Hook3 UTSW 8 26044278 intron probably benign
R6082:Hook3 UTSW 8 26110785 missense probably benign 0.00
R6124:Hook3 UTSW 8 26059272 missense probably benign 0.20
R6301:Hook3 UTSW 8 26034940 nonsense probably null
R6314:Hook3 UTSW 8 26088108 missense probably benign
R6448:Hook3 UTSW 8 26093664 missense probably benign 0.02
R6810:Hook3 UTSW 8 26032422 splice site probably null
Predicted Primers PCR Primer
(F):5'- AGTCAGAAATGAGGTATATTCCAGC -3'
(R):5'- AGGATCTTCATATACCTGTAGACGAG -3'

Sequencing Primer
(F):5'- GCCTTAATTTCTGCACTCTGAGAAAC -3'
(R):5'- TCATATACCTGTAGACGAGATTGATG -3'
Posted On2014-06-23