Incidental Mutation 'R1806:Olfr228'
ID203434
Institutional Source Beutler Lab
Gene Symbol Olfr228
Ensembl Gene ENSMUSG00000111772
Gene Name
SynonymsMOR189-3, GA_x6K02T0101M-139-669
MMRRC Submission 039835-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R1806 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location86481921-86487386 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 86483139 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 201 (I201N)
Gene Model predicted gene model for transcript(s): [ENSMUST00000216534] [ENSMUST00000217292]
Predicted Effect probably damaging
Transcript: ENSMUST00000099883
AA Change: I201N

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097468
Gene: ENSMUSG00000075180
AA Change: I201N

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 1.5e-54 PFAM
Pfam:7tm_1 41 290 5.6e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000117635
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215705
Predicted Effect probably damaging
Transcript: ENSMUST00000216534
AA Change: I201N

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000217292
AA Change: I201N

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
Meta Mutation Damage Score 0.274 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.8%
  • 10x: 94.9%
  • 20x: 91.2%
Validation Efficiency 96% (77/80)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8430408G22Rik G A 6: 116,651,722 V9M possibly damaging Het
Adamts15 C A 9: 30,904,815 C616F probably damaging Het
Adarb1 T C 10: 77,322,265 N116S probably damaging Het
Add2 C T 6: 86,118,657 S437L probably damaging Het
Adra1d T A 2: 131,546,149 R495S probably benign Het
Agk C T 6: 40,387,495 T309I probably damaging Het
Aqr T C 2: 114,161,652 Y81C probably damaging Het
Bak1 G A 17: 27,021,268 Q142* probably null Het
Bckdha A G 7: 25,631,420 V307A probably damaging Het
Camk2n2 C A 16: 20,620,198 G72V probably benign Het
Cd276 A T 9: 58,527,562 probably benign Het
Cd2ap G A 17: 42,838,758 Q122* probably null Het
Cdan1 T A 2: 120,731,426 probably benign Het
Cdh3 T C 8: 106,536,915 S156P probably benign Het
Chil4 T A 3: 106,210,643 probably benign Het
Col11a1 C T 3: 114,158,142 R1074C probably damaging Het
Fcrlb T C 1: 170,907,527 T344A probably benign Het
Fras1 T A 5: 96,713,970 probably benign Het
Fras1 G T 5: 96,764,976 V3380F possibly damaging Het
Galnt9 A G 5: 110,619,253 D530G possibly damaging Het
Gja10 A T 4: 32,601,135 S416R probably benign Het
Gm10549 T A 18: 33,470,788 V108E unknown Het
Gm8298 T C 3: 59,877,150 L348P probably damaging Het
Hook3 A T 8: 26,068,659 L59Q probably damaging Het
Hpf1 T A 8: 60,900,120 D178E probably benign Het
Hsd17b7 T C 1: 169,961,129 N173S possibly damaging Het
Hsph1 A G 5: 149,629,989 F236L probably damaging Het
Kcnk12 G T 17: 87,746,109 T375K probably benign Het
Kdelc2 T C 9: 53,395,850 Y365H probably damaging Het
Klra3 A T 6: 130,327,070 S220T probably damaging Het
Lhx1 A T 11: 84,524,141 L12Q probably damaging Het
Lnx1 A G 5: 74,606,049 L468P probably damaging Het
Ltbp3 T A 19: 5,753,942 C827* probably null Het
Mical1 C T 10: 41,478,214 A53V probably damaging Het
Mmp10 A T 9: 7,506,501 H326L probably benign Het
Mpl A T 4: 118,443,532 M600K possibly damaging Het
Muc5b T A 7: 141,865,493 D4004E possibly damaging Het
Myo5b A T 18: 74,577,609 H98L possibly damaging Het
Nbeal1 A G 1: 60,284,092 T2110A probably damaging Het
Nedd4l C A 18: 65,212,791 R825S probably damaging Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Olfr1277 A T 2: 111,270,277 I30N possibly damaging Het
Olfr596 T A 7: 103,310,225 L168Q probably damaging Het
Otog A T 7: 46,290,937 probably null Het
Parp2 T A 14: 50,819,379 L320H probably damaging Het
Pola2 C T 19: 5,943,222 probably null Het
Poln A T 5: 34,107,150 probably benign Het
Pomt1 T A 2: 32,241,668 V123E probably damaging Het
Prom2 T C 2: 127,532,882 Y578C probably damaging Het
Prss23 T C 7: 89,510,391 T157A probably damaging Het
Sdk1 T A 5: 141,613,195 V205E probably damaging Het
Sdk1 A G 5: 142,161,926 K1771R probably benign Het
Sidt1 A T 16: 44,281,871 S309T possibly damaging Het
Sirpa T A 2: 129,615,512 F169I probably damaging Het
Slc8a1 T C 17: 81,648,487 N374S probably damaging Het
Sp110 C T 1: 85,596,110 probably null Het
Stard9 A G 2: 120,679,453 probably null Het
Synpr A G 14: 13,563,082 N105S probably damaging Het
Tbc1d16 T C 11: 119,156,101 Y440C probably damaging Het
Trabd A G 15: 89,085,621 I313V possibly damaging Het
Trappc10 T C 10: 78,210,776 R430G probably damaging Het
Trim50 A G 5: 135,358,889 E145G probably benign Het
Uba2 A T 7: 34,163,199 F105I probably damaging Het
Uba3 A G 6: 97,199,269 V92A possibly damaging Het
Uhmk1 T C 1: 170,211,059 K153R probably damaging Het
Vmn2r3 T A 3: 64,275,472 M269L probably benign Het
Vmn2r3 T C 3: 64,287,389 K8R possibly damaging Het
Xpot G T 10: 121,607,638 probably benign Het
Zfp128 A G 7: 12,891,022 Y439C probably benign Het
Zfy1 T A Y: 725,620 H715L possibly damaging Het
Zmym1 A C 4: 127,048,079 L839V probably damaging Het
Other mutations in Olfr228
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Olfr228 APN 2 86483218 missense probably benign 0.05
IGL02136:Olfr228 APN 2 86483465 missense probably damaging 1.00
IGL02419:Olfr228 APN 2 86482915 missense probably damaging 0.99
IGL03008:Olfr228 APN 2 86483334 missense probably damaging 1.00
R0240:Olfr228 UTSW 2 86483386 missense possibly damaging 0.78
R0240:Olfr228 UTSW 2 86483386 missense possibly damaging 0.78
R1073:Olfr228 UTSW 2 86483640 missense probably damaging 0.98
R1163:Olfr228 UTSW 2 86483238 missense probably damaging 1.00
R1505:Olfr228 UTSW 2 86483213 missense possibly damaging 0.94
R1940:Olfr228 UTSW 2 86483359 nonsense probably null
R3025:Olfr228 UTSW 2 86483739 start codon destroyed probably null 1.00
R3037:Olfr228 UTSW 2 86483643 missense probably damaging 0.96
R5156:Olfr228 UTSW 2 86483018 nonsense probably null
R6459:Olfr228 UTSW 2 86483229 missense probably benign 0.23
R6472:Olfr228 UTSW 2 86483190 nonsense probably null
R6493:Olfr228 UTSW 2 86483221 missense possibly damaging 0.59
R6880:Olfr228 UTSW 2 86483725 missense probably benign
X0028:Olfr228 UTSW 2 86482890 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGATAGAAGCCACCTTGTCAG -3'
(R):5'- TGGGTTCTAGTGGCCATTCC -3'

Sequencing Primer
(F):5'- GTCACTGGACTTAGGTTGCACATAC -3'
(R):5'- AGTGGCCATTCCTTACATTTACAG -3'
Posted On2014-06-23