Incidental Mutation 'R1938:Muc6'
ID213696
Institutional Source Beutler Lab
Gene Symbol Muc6
Ensembl Gene ENSMUSG00000048191
Gene Namemucin 6, gastric
Synonyms
MMRRC Submission 039956-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R1938 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location141633456-141655319 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 141637098 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 2489 (L2489P)
Ref Sequence ENSEMBL: ENSMUSP00000049941 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003038] [ENSMUST00000062451] [ENSMUST00000189314] [ENSMUST00000190907]
Predicted Effect probably benign
Transcript: ENSMUST00000003038
SMART Domains Protein: ENSMUSP00000003038
Gene: ENSMUSG00000002957

DomainStartEndE-ValueType
Pfam:Adaptin_N 29 590 1.7e-147 PFAM
low complexity region 646 659 N/A INTRINSIC
low complexity region 661 684 N/A INTRINSIC
Alpha_adaptinC2 706 819 1.45e-26 SMART
Pfam:Alpha_adaptin_C 825 933 2.8e-47 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000062451
AA Change: L2489P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000049941
Gene: ENSMUSG00000048191
AA Change: L2489P

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
VWD 29 234 2.49e-14 SMART
C8 267 340 5.46e-3 SMART
Pfam:TIL 344 399 5.6e-14 PFAM
VWC 401 469 2.57e-7 SMART
VWD 428 591 4.81e-30 SMART
C8 627 703 8.84e-21 SMART
SCOP:d1coua_ 706 769 7e-9 SMART
Pfam:TIL 806 869 1.9e-9 PFAM
VWC 871 941 8.52e-3 SMART
VWD 898 1060 1.59e-30 SMART
C8 1096 1170 5.52e-31 SMART
Blast:CT 1184 1236 2e-19 BLAST
low complexity region 1240 1269 N/A INTRINSIC
low complexity region 1275 1293 N/A INTRINSIC
low complexity region 1313 1337 N/A INTRINSIC
low complexity region 1345 1374 N/A INTRINSIC
internal_repeat_3 1375 1560 6.78e-17 PROSPERO
internal_repeat_2 1426 1751 8.94e-34 PROSPERO
low complexity region 1761 1780 N/A INTRINSIC
low complexity region 1867 1887 N/A INTRINSIC
low complexity region 1896 1910 N/A INTRINSIC
low complexity region 1912 1946 N/A INTRINSIC
low complexity region 1990 2004 N/A INTRINSIC
low complexity region 2010 2020 N/A INTRINSIC
internal_repeat_2 2036 2430 8.94e-34 PROSPERO
internal_repeat_3 2329 2516 6.78e-17 PROSPERO
low complexity region 2519 2536 N/A INTRINSIC
low complexity region 2564 2587 N/A INTRINSIC
low complexity region 2605 2630 N/A INTRINSIC
low complexity region 2642 2677 N/A INTRINSIC
low complexity region 2729 2762 N/A INTRINSIC
Blast:CT 2765 2852 1e-44 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000189314
SMART Domains Protein: ENSMUSP00000140388
Gene: ENSMUSG00000048191

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
VWD 29 193 2.64e-27 SMART
C8 226 299 5.46e-3 SMART
Pfam:TIL 303 358 1.4e-13 PFAM
VWC 360 428 2.57e-7 SMART
VWD 387 550 4.81e-30 SMART
C8 586 662 8.84e-21 SMART
internal_repeat_2 665 754 5.76e-7 PROSPERO
Pfam:TIL 765 828 6.4e-9 PFAM
VWC 830 900 8.52e-3 SMART
VWD 857 1019 1.59e-30 SMART
C8 1055 1129 5.52e-31 SMART
low complexity region 1199 1228 N/A INTRINSIC
low complexity region 1234 1252 N/A INTRINSIC
low complexity region 1272 1296 N/A INTRINSIC
low complexity region 1304 1333 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000190907
AA Change: L2554P

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000140483
Gene: ENSMUSG00000048191
AA Change: L2554P

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
VWD 29 234 1.2e-16 SMART
C8 267 340 4.2e-7 SMART
Pfam:TIL 344 399 7.2e-11 PFAM
VWC_def 401 469 1.2e-9 SMART
VWD 428 591 2.4e-32 SMART
C8 627 703 6.7e-25 SMART
SCOP:d1coua_ 706 769 5e-9 SMART
Pfam:TIL 806 869 3.3e-6 PFAM
VWC_def 871 941 4.1e-5 SMART
VWD 898 1060 7.7e-33 SMART
C8 1096 1170 4.2e-35 SMART
Blast:CT 1184 1236 2e-19 BLAST
low complexity region 1240 1269 N/A INTRINSIC
low complexity region 1275 1293 N/A INTRINSIC
low complexity region 1313 1337 N/A INTRINSIC
low complexity region 1345 1374 N/A INTRINSIC
low complexity region 1406 1419 N/A INTRINSIC
internal_repeat_1 1426 1822 3.44e-48 PROSPERO
low complexity region 1826 1845 N/A INTRINSIC
low complexity region 1932 1952 N/A INTRINSIC
low complexity region 1961 1975 N/A INTRINSIC
low complexity region 1977 2011 N/A INTRINSIC
low complexity region 2055 2069 N/A INTRINSIC
low complexity region 2075 2085 N/A INTRINSIC
internal_repeat_1 2101 2501 3.44e-48 PROSPERO
low complexity region 2504 2524 N/A INTRINSIC
low complexity region 2584 2601 N/A INTRINSIC
low complexity region 2629 2652 N/A INTRINSIC
low complexity region 2670 2695 N/A INTRINSIC
low complexity region 2707 2742 N/A INTRINSIC
low complexity region 2794 2827 N/A INTRINSIC
Blast:CT 2830 2917 1e-44 BLAST
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mucin protein family. Mucins are high molecular weight glycoproteins produced by many epithelial tissues. The protein encoded by this gene is secreted and forms an insoluble mucous barrier that protects the gut lumen. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 133 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik T C 1: 93,152,008 *453W probably null Het
Abcc8 T C 7: 46,175,371 K134R possibly damaging Het
Adamts17 T C 7: 67,125,072 S980P probably damaging Het
Adap2 T A 11: 80,170,682 I221K probably damaging Het
Adgrv1 C T 13: 81,391,757 R5681Q probably damaging Het
Adipor1 T A 1: 134,423,103 L30Q probably benign Het
Agpat5 A G 8: 18,878,165 T249A probably benign Het
Agxt2 G T 15: 10,391,935 G329V probably damaging Het
Ankrd28 A G 14: 31,705,276 V801A possibly damaging Het
Ap1g2 A G 14: 55,099,772 V702A possibly damaging Het
Arid3a A G 10: 79,950,706 Q429R probably damaging Het
Arsb T A 13: 93,862,150 L322Q probably damaging Het
Ash1l A G 3: 88,984,422 T1203A probably damaging Het
Atad2 T A 15: 58,096,705 N1308Y possibly damaging Het
Atp10b A T 11: 43,230,418 R969S probably benign Het
Bmp10 T C 6: 87,433,720 I165T possibly damaging Het
Ccne1 A G 7: 38,106,277 probably null Het
Cenpe A G 3: 135,247,479 N1565D probably damaging Het
Chd1 A T 17: 15,762,486 E1404D probably benign Het
Chd7 G A 4: 8,847,200 E1648K probably damaging Het
Chodl T C 16: 78,941,426 I94T possibly damaging Het
Chsy3 T C 18: 59,409,512 F574S probably damaging Het
Clpb A T 7: 101,763,656 I317F probably damaging Het
Cnga3 T A 1: 37,261,873 V558D possibly damaging Het
Col9a1 C T 1: 24,222,473 P573S probably damaging Het
Crat A T 2: 30,413,061 D71E probably benign Het
Cspg4 A G 9: 56,887,101 T707A probably benign Het
Ctsr T A 13: 61,162,445 R132S probably benign Het
Ctu2 T C 8: 122,479,285 L255P probably damaging Het
Cyp2c69 T C 19: 39,849,366 Y424C probably damaging Het
Ddx27 A T 2: 167,034,109 K726N probably damaging Het
Dennd4a A G 9: 64,842,490 Q121R probably damaging Het
Dis3 A G 14: 99,097,590 F192S probably benign Het
Ect2l C T 10: 18,144,635 S487N probably benign Het
Eml1 T A 12: 108,521,396 F524L possibly damaging Het
Espl1 T C 15: 102,305,042 I601T probably benign Het
Fbxo40 C A 16: 36,969,351 V466L probably damaging Het
Frmpd1 C T 4: 45,283,711 T844M probably damaging Het
Frs2 T A 10: 117,081,106 probably benign Het
Fuom G T 7: 140,099,608 T133K probably benign Het
Garnl3 T A 2: 33,005,200 H619L probably damaging Het
Gm4861 G T 3: 137,552,115 N36K unknown Het
Gm6588 C A 5: 112,449,801 C71* probably null Het
Gps2 G T 11: 69,915,369 M153I probably benign Het
Gtf2ird1 A G 5: 134,415,245 V52A probably damaging Het
Gtpbp8 A T 16: 44,745,422 D137E probably benign Het
Haus4 A G 14: 54,544,276 C213R probably damaging Het
Hdc T A 2: 126,606,397 H142L possibly damaging Het
Hephl1 T C 9: 15,053,987 D1069G possibly damaging Het
Herc6 T A 6: 57,625,941 V535D probably damaging Het
Hipk3 A T 2: 104,430,188 H1082Q possibly damaging Het
Hps5 A T 7: 46,773,267 V513D probably damaging Het
Ifna13 T A 4: 88,644,175 I71F probably damaging Het
Il1rl2 T C 1: 40,363,324 I426T probably damaging Het
Irf5 A T 6: 29,536,739 D483V probably benign Het
Jakmip3 A G 7: 139,020,138 R256G probably damaging Het
Jazf1 T C 6: 52,777,615 I159V probably damaging Het
Kmo A G 1: 175,651,588 D230G possibly damaging Het
Lrrc74b A G 16: 17,553,194 V213A probably benign Het
Ly6g5b T C 17: 35,114,728 D36G possibly damaging Het
Macc1 T G 12: 119,445,731 L78R probably damaging Het
Mettl4 A T 17: 94,747,857 D51E possibly damaging Het
Mfap1a G A 2: 121,502,354 L199F possibly damaging Het
Mmp17 G T 5: 129,602,126 R363L probably damaging Het
Mrc1 G A 2: 14,319,241 A1130T possibly damaging Het
Mrpl15 C T 1: 4,777,582 A165T probably damaging Het
Mrpl45 G A 11: 97,315,944 probably null Het
Ms4a3 C T 19: 11,635,840 A85T possibly damaging Het
Mttp A T 3: 138,125,121 D77E probably benign Het
Myl3 G A 9: 110,766,734 E100K probably damaging Het
Nbea T A 3: 56,085,322 N288Y probably damaging Het
Ncoa7 A G 10: 30,698,170 V181A probably benign Het
Oat C T 7: 132,558,205 V429M probably benign Het
Olfr1152 G A 2: 87,868,461 V157I probably benign Het
Olfr1163 A T 2: 88,070,956 L142Q probably damaging Het
Olfr1269 T G 2: 90,119,083 I172L probably damaging Het
Olfr285 T A 15: 98,313,380 M57L probably damaging Het
Olfr319 A T 11: 58,702,623 *307C probably null Het
Olfr508 T C 7: 108,630,838 I282T probably benign Het
Olfr524 A G 7: 140,202,231 F180L probably benign Het
Olfr810 T A 10: 129,790,890 K233M probably damaging Het
Olfr922 A G 9: 38,815,850 T116A probably benign Het
Oraov1 A G 7: 144,916,468 S45G probably damaging Het
Otof A G 5: 30,376,369 S1464P probably benign Het
Otogl A T 10: 107,777,575 Y2010N probably damaging Het
Pgap3 C T 11: 98,400,214 probably null Het
Pgbd5 T A 8: 124,374,249 K332* probably null Het
Pgs1 C T 11: 118,005,727 P410L probably damaging Het
Pkhd1l1 G A 15: 44,500,038 S618N probably benign Het
Plcb1 A T 2: 135,386,302 D1073V probably damaging Het
Pola2 T A 19: 5,951,180 T309S probably benign Het
Polg2 T A 11: 106,778,961 H161L probably damaging Het
Postn T A 3: 54,377,612 probably null Het
Ppt1 G T 4: 122,845,991 C128F probably damaging Het
Ptpn12 G A 5: 20,993,263 P678S probably damaging Het
Rcan3 A T 4: 135,412,501 probably null Het
Rgs22 T C 15: 36,101,804 N216S probably benign Het
Rgs7bp T A 13: 104,951,582 D228V probably damaging Het
Rhobtb2 A T 14: 69,796,613 S388T probably benign Het
Rnps1 C T 17: 24,420,390 R138C unknown Het
Rpl38 T C 11: 114,671,776 V36A probably benign Het
Rps7 G T 12: 28,631,753 H126Q possibly damaging Het
Sec24b G T 3: 129,991,361 Q999K possibly damaging Het
Slc19a3 A G 1: 83,019,368 V373A possibly damaging Het
Spats2l T A 1: 57,885,782 V113E probably benign Het
Ss18l1 A T 2: 180,063,345 T377S unknown Het
Surf1 A G 2: 26,915,970 F38L probably benign Het
Ticrr G A 7: 79,675,394 R556H probably damaging Het
Tmem184b A G 15: 79,365,814 S254P probably damaging Het
Tnfrsf4 G T 4: 156,016,235 R237L possibly damaging Het
Tnk2 C A 16: 32,663,742 probably benign Het
Tnks A T 8: 34,838,530 D1191E probably damaging Het
Tnr C A 1: 159,895,037 Y1017* probably null Het
Tomm34 A G 2: 164,061,006 I128T probably benign Het
Trim2 G A 3: 84,177,792 S540F possibly damaging Het
Trio A T 15: 27,732,891 I2968N probably damaging Het
Ttc24 T C 3: 88,074,874 E17G probably benign Het
Ttc41 A G 10: 86,776,214 H1117R probably benign Het
Ttn A T 2: 76,735,408 V28200D probably damaging Het
Ttn A T 2: 76,762,386 S20801T possibly damaging Het
Ube2cbp C T 9: 86,448,787 C114Y probably damaging Het
Ugt2b37 A C 5: 87,240,857 L499R probably damaging Het
Vmn1r81 T C 7: 12,260,662 I6M possibly damaging Het
Vmn2r97 A T 17: 18,929,331 Y327F probably benign Het
Vps13b T C 15: 35,709,507 S1867P probably damaging Het
Wdr11 T C 7: 129,606,607 V362A probably benign Het
Zan T A 5: 137,388,939 M4951L unknown Het
Zcwpw1 T A 5: 137,811,622 L337Q probably damaging Het
Zfp2 A T 11: 50,899,982 D411E possibly damaging Het
Zfp628 C T 7: 4,920,768 T663I probably benign Het
Zfpm1 T A 8: 122,334,924 probably null Het
Zfyve19 T C 2: 119,211,212 S87P probably benign Het
Zswim9 T A 7: 13,260,214 K672* probably null Het
Other mutations in Muc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Muc6 APN 7 141638584 missense probably benign 0.06
IGL00466:Muc6 APN 7 141645902 missense possibly damaging 0.94
IGL00990:Muc6 APN 7 141638890 missense possibly damaging 0.85
IGL01013:Muc6 APN 7 141648066 nonsense probably null
IGL01021:Muc6 APN 7 141637162 missense possibly damaging 0.53
IGL01061:Muc6 APN 7 141648454 missense probably damaging 1.00
IGL01294:Muc6 APN 7 141646659 missense probably damaging 1.00
IGL01449:Muc6 APN 7 141638614 missense possibly damaging 0.92
IGL01474:Muc6 APN 7 141651307 missense probably damaging 1.00
IGL01539:Muc6 APN 7 141650041 missense probably benign 0.07
IGL01541:Muc6 APN 7 141649804 nonsense probably null
IGL01810:Muc6 APN 7 141651062 missense probably damaging 0.97
IGL01941:Muc6 APN 7 141638584 missense probably benign 0.06
IGL01954:Muc6 APN 7 141638584 missense probably benign 0.06
IGL02096:Muc6 APN 7 141639850 intron probably benign
IGL02192:Muc6 APN 7 141637804 missense possibly damaging 0.91
IGL02217:Muc6 APN 7 141649624 missense probably damaging 1.00
IGL02234:Muc6 APN 7 141640575 missense probably benign 0.09
IGL02302:Muc6 APN 7 141641496 missense possibly damaging 0.53
IGL02331:Muc6 APN 7 141640459 missense possibly damaging 0.53
IGL02531:Muc6 APN 7 141636940 missense possibly damaging 0.53
IGL02639:Muc6 APN 7 141649578 splice site probably benign
IGL02851:Muc6 APN 7 141648361 missense probably damaging 1.00
IGL03026:Muc6 APN 7 141640147 intron probably benign
IGL03070:Muc6 APN 7 141644567 splice site probably benign
IGL03108:Muc6 APN 7 141637489 missense possibly damaging 0.93
IGL03350:Muc6 APN 7 141652059 missense probably damaging 1.00
IGL03366:Muc6 APN 7 141648082 missense probably damaging 1.00
F5770:Muc6 UTSW 7 141647613 missense probably benign 0.11
IGL03147:Muc6 UTSW 7 141638400 missense possibly damaging 0.95
R0001:Muc6 UTSW 7 141641574 missense possibly damaging 0.53
R0005:Muc6 UTSW 7 141638772 missense possibly damaging 0.72
R0147:Muc6 UTSW 7 141651990 missense probably damaging 1.00
R0153:Muc6 UTSW 7 141634116 missense possibly damaging 0.68
R0227:Muc6 UTSW 7 141639559 intron probably benign
R0234:Muc6 UTSW 7 141649674 missense possibly damaging 0.95
R0234:Muc6 UTSW 7 141649674 missense possibly damaging 0.95
R0304:Muc6 UTSW 7 141638400 missense possibly damaging 0.95
R0379:Muc6 UTSW 7 141636955 missense possibly damaging 0.53
R0385:Muc6 UTSW 7 141638400 missense possibly damaging 0.95
R0423:Muc6 UTSW 7 141652283 missense probably benign 0.01
R0499:Muc6 UTSW 7 141640468 missense probably benign
R0503:Muc6 UTSW 7 141638772 missense possibly damaging 0.72
R0757:Muc6 UTSW 7 141638584 missense probably benign 0.06
R0792:Muc6 UTSW 7 141639559 intron probably benign
R0880:Muc6 UTSW 7 141637357 missense possibly damaging 0.91
R1136:Muc6 UTSW 7 141638772 missense possibly damaging 0.72
R1170:Muc6 UTSW 7 141644233 missense probably damaging 0.99
R1174:Muc6 UTSW 7 141648101 missense probably damaging 1.00
R1175:Muc6 UTSW 7 141648101 missense probably damaging 1.00
R1189:Muc6 UTSW 7 141645855 missense probably damaging 1.00
R1259:Muc6 UTSW 7 141640197 intron probably benign
R1293:Muc6 UTSW 7 141651990 missense probably damaging 1.00
R1295:Muc6 UTSW 7 141651879 missense probably benign 0.04
R1296:Muc6 UTSW 7 141651879 missense probably benign 0.04
R1471:Muc6 UTSW 7 141647909 missense possibly damaging 0.61
R1472:Muc6 UTSW 7 141651879 missense probably benign 0.04
R1548:Muc6 UTSW 7 141652103 splice site probably benign
R1548:Muc6 UTSW 7 141638772 missense possibly damaging 0.72
R1576:Muc6 UTSW 7 141634524 missense possibly damaging 0.92
R1689:Muc6 UTSW 7 141647998 missense probably damaging 1.00
R1702:Muc6 UTSW 7 141650487 missense probably damaging 1.00
R1792:Muc6 UTSW 7 141634458 missense probably benign 0.41
R1924:Muc6 UTSW 7 141638400 missense possibly damaging 0.95
R1964:Muc6 UTSW 7 141640062 nonsense probably null
R1964:Muc6 UTSW 7 141640063 intron probably benign
R1975:Muc6 UTSW 7 141648101 missense probably damaging 1.00
R2031:Muc6 UTSW 7 141638400 missense possibly damaging 0.95
R2104:Muc6 UTSW 7 141634078 missense probably benign 0.23
R2201:Muc6 UTSW 7 141649810 missense probably damaging 1.00
R2218:Muc6 UTSW 7 141646960 missense probably benign 0.41
R2245:Muc6 UTSW 7 141638400 missense possibly damaging 0.95
R2261:Muc6 UTSW 7 141638400 missense possibly damaging 0.95
R2271:Muc6 UTSW 7 141637510 missense possibly damaging 0.53
R2272:Muc6 UTSW 7 141637510 missense possibly damaging 0.53
R2284:Muc6 UTSW 7 141637924 missense possibly damaging 0.53
R2310:Muc6 UTSW 7 141637531 missense possibly damaging 0.53
R2566:Muc6 UTSW 7 141640384 missense possibly damaging 0.73
R2975:Muc6 UTSW 7 141637038 missense possibly damaging 0.86
R3406:Muc6 UTSW 7 141638400 missense possibly damaging 0.95
R3423:Muc6 UTSW 7 141638400 missense possibly damaging 0.95
R3548:Muc6 UTSW 7 141638400 missense possibly damaging 0.95
R3693:Muc6 UTSW 7 141648681 splice site probably benign
R3872:Muc6 UTSW 7 141640600 missense probably benign
R4029:Muc6 UTSW 7 141638400 missense possibly damaging 0.95
R4084:Muc6 UTSW 7 141648655 missense probably damaging 1.00
R4126:Muc6 UTSW 7 141638400 missense possibly damaging 0.95
R4410:Muc6 UTSW 7 141637663 missense possibly damaging 0.91
R4508:Muc6 UTSW 7 141640089 intron probably benign
R4509:Muc6 UTSW 7 141638400 missense possibly damaging 0.95
R4518:Muc6 UTSW 7 141644222 missense probably benign 0.03
R4594:Muc6 UTSW 7 141638772 missense possibly damaging 0.72
R4677:Muc6 UTSW 7 141639790 intron probably benign
R4678:Muc6 UTSW 7 141644287 missense probably benign 0.09
R4737:Muc6 UTSW 7 141640159 intron probably benign
R4737:Muc6 UTSW 7 141638772 missense possibly damaging 0.72
R4981:Muc6 UTSW 7 141638400 missense possibly damaging 0.95
R5008:Muc6 UTSW 7 141639559 intron probably benign
R5012:Muc6 UTSW 7 141636657 missense possibly damaging 0.96
R5017:Muc6 UTSW 7 141640528 missense probably benign
R5027:Muc6 UTSW 7 141636436 missense probably benign 0.01
R5058:Muc6 UTSW 7 141644224 missense probably benign 0.01
R5069:Muc6 UTSW 7 141651299 missense probably damaging 1.00
R5126:Muc6 UTSW 7 141651299 missense probably damaging 1.00
R5168:Muc6 UTSW 7 141639559 intron probably benign
R5179:Muc6 UTSW 7 141638772 missense possibly damaging 0.72
R5198:Muc6 UTSW 7 141638772 missense possibly damaging 0.72
R5262:Muc6 UTSW 7 141651110 missense possibly damaging 0.78
R5381:Muc6 UTSW 7 141637923 missense possibly damaging 0.86
R5454:Muc6 UTSW 7 141648813 missense possibly damaging 0.61
R5467:Muc6 UTSW 7 141636535 missense possibly damaging 0.53
R5540:Muc6 UTSW 7 141649585 critical splice donor site probably null
R5800:Muc6 UTSW 7 141640423 splice site probably benign
R5808:Muc6 UTSW 7 141640093 intron probably benign
R5865:Muc6 UTSW 7 141650504 missense probably damaging 0.97
R5919:Muc6 UTSW 7 141641570 missense possibly damaging 0.56
R6024:Muc6 UTSW 7 141641574 missense possibly damaging 0.53
R6064:Muc6 UTSW 7 141648374 missense probably damaging 1.00
R6126:Muc6 UTSW 7 141638772 missense possibly damaging 0.72
R6229:Muc6 UTSW 7 141640525 missense probably benign
R6236:Muc6 UTSW 7 141638772 missense possibly damaging 0.72
R6245:Muc6 UTSW 7 141648821 missense probably damaging 1.00
R6254:Muc6 UTSW 7 141651115 missense probably benign 0.09
R6418:Muc6 UTSW 7 141639610 intron probably benign
R6609:Muc6 UTSW 7 141640433 splice site probably benign
R6610:Muc6 UTSW 7 141640433 splice site probably benign
R6611:Muc6 UTSW 7 141640433 splice site probably benign
R6623:Muc6 UTSW 7 141639559 intron probably benign
R6626:Muc6 UTSW 7 141639559 intron probably benign
R6817:Muc6 UTSW 7 141651061 missense probably damaging 0.99
R6923:Muc6 UTSW 7 141637540 missense possibly damaging 0.91
R6989:Muc6 UTSW 7 141639979 intron probably benign
R7001:Muc6 UTSW 7 141637407 missense probably damaging 0.99
R7046:Muc6 UTSW 7 141640189 intron probably benign
R7097:Muc6 UTSW 7 141634450 frame shift probably null
R7099:Muc6 UTSW 7 141634450 frame shift probably null
R7101:Muc6 UTSW 7 141634450 frame shift probably null
R7107:Muc6 UTSW 7 141634450 frame shift probably null
R7108:Muc6 UTSW 7 141634450 frame shift probably null
R7112:Muc6 UTSW 7 141649277 missense probably damaging 1.00
R7121:Muc6 UTSW 7 141634450 frame shift probably null
R7202:Muc6 UTSW 7 141634450 frame shift probably null
R7204:Muc6 UTSW 7 141634450 frame shift probably null
R7205:Muc6 UTSW 7 141634450 frame shift probably null
R7206:Muc6 UTSW 7 141634450 frame shift probably null
R7222:Muc6 UTSW 7 141634515 missense unknown
R7230:Muc6 UTSW 7 141649214 missense probably damaging 1.00
V7581:Muc6 UTSW 7 141647613 missense probably benign 0.11
V7583:Muc6 UTSW 7 141647613 missense probably benign 0.11
X0026:Muc6 UTSW 7 141651699 missense possibly damaging 0.94
X0058:Muc6 UTSW 7 141638400 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TCTGGTTGTGGGAAAAGAGC -3'
(R):5'- TGGGTGTAACTGGTACTCCAC -3'

Sequencing Primer
(F):5'- CACTGGTTGTGTTAATGTCGGATAC -3'
(R):5'- GGTACTCCACCGGTCCACAC -3'
Posted On2014-07-14