Incidental Mutation 'R2011:Piezo2'
ID219822
Institutional Source Beutler Lab
Gene Symbol Piezo2
Ensembl Gene ENSMUSG00000041482
Gene Namepiezo-type mechanosensitive ion channel component 2
SynonymsFam38b, Fam38b2, 9030411M15Rik, Piezo2, 9430028L06Rik
MMRRC Submission 040020-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2011 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location63010213-63387183 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 63059744 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1605 (T1605A)
Ref Sequence ENSEMBL: ENSMUSP00000040019 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047480] [ENSMUST00000183217]
Predicted Effect probably damaging
Transcript: ENSMUST00000047480
AA Change: T1605A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000040019
Gene: ENSMUSG00000041482
AA Change: T1605A

DomainStartEndE-ValueType
transmembrane domain 13 44 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
low complexity region 179 194 N/A INTRINSIC
transmembrane domain 214 236 N/A INTRINSIC
transmembrane domain 241 260 N/A INTRINSIC
transmembrane domain 267 289 N/A INTRINSIC
coiled coil region 455 482 N/A INTRINSIC
transmembrane domain 504 526 N/A INTRINSIC
transmembrane domain 539 561 N/A INTRINSIC
SCOP:d1eq1a_ 597 666 4e-3 SMART
transmembrane domain 682 704 N/A INTRINSIC
transmembrane domain 708 730 N/A INTRINSIC
internal_repeat_1 740 764 6.01e-5 PROSPERO
low complexity region 772 784 N/A INTRINSIC
transmembrane domain 791 813 N/A INTRINSIC
low complexity region 900 921 N/A INTRINSIC
transmembrane domain 949 971 N/A INTRINSIC
transmembrane domain 976 993 N/A INTRINSIC
transmembrane domain 1000 1022 N/A INTRINSIC
transmembrane domain 1069 1091 N/A INTRINSIC
transmembrane domain 1130 1152 N/A INTRINSIC
transmembrane domain 1156 1173 N/A INTRINSIC
transmembrane domain 1186 1208 N/A INTRINSIC
transmembrane domain 1234 1256 N/A INTRINSIC
transmembrane domain 1308 1327 N/A INTRINSIC
transmembrane domain 1331 1353 N/A INTRINSIC
Pfam:PIEZO 1383 1617 1.1e-105 PFAM
low complexity region 1807 1823 N/A INTRINSIC
low complexity region 1836 1860 N/A INTRINSIC
low complexity region 1863 1878 N/A INTRINSIC
transmembrane domain 1981 2003 N/A INTRINSIC
transmembrane domain 2010 2027 N/A INTRINSIC
internal_repeat_1 2036 2060 6.01e-5 PROSPERO
low complexity region 2167 2199 N/A INTRINSIC
transmembrane domain 2261 2283 N/A INTRINSIC
transmembrane domain 2303 2325 N/A INTRINSIC
transmembrane domain 2332 2354 N/A INTRINSIC
transmembrane domain 2364 2386 N/A INTRINSIC
Pfam:Piezo_RRas_bdg 2412 2821 2.8e-161 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000183217
AA Change: T1591A

PolyPhen 2 Score 0.636 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000138758
Gene: ENSMUSG00000041482
AA Change: T1591A

DomainStartEndE-ValueType
transmembrane domain 13 44 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
low complexity region 179 194 N/A INTRINSIC
transmembrane domain 214 236 N/A INTRINSIC
transmembrane domain 241 260 N/A INTRINSIC
transmembrane domain 267 289 N/A INTRINSIC
coiled coil region 455 482 N/A INTRINSIC
transmembrane domain 504 526 N/A INTRINSIC
transmembrane domain 539 561 N/A INTRINSIC
SCOP:d1eq1a_ 597 666 4e-3 SMART
transmembrane domain 682 704 N/A INTRINSIC
transmembrane domain 708 730 N/A INTRINSIC
transmembrane domain 737 759 N/A INTRINSIC
low complexity region 772 784 N/A INTRINSIC
transmembrane domain 791 813 N/A INTRINSIC
low complexity region 886 907 N/A INTRINSIC
transmembrane domain 935 957 N/A INTRINSIC
transmembrane domain 962 979 N/A INTRINSIC
transmembrane domain 986 1008 N/A INTRINSIC
transmembrane domain 1055 1077 N/A INTRINSIC
transmembrane domain 1116 1138 N/A INTRINSIC
transmembrane domain 1142 1159 N/A INTRINSIC
transmembrane domain 1172 1194 N/A INTRINSIC
transmembrane domain 1220 1242 N/A INTRINSIC
transmembrane domain 1294 1313 N/A INTRINSIC
transmembrane domain 1317 1339 N/A INTRINSIC
transmembrane domain 1352 1374 N/A INTRINSIC
coiled coil region 1460 1501 N/A INTRINSIC
low complexity region 1528 1537 N/A INTRINSIC
low complexity region 1558 1575 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains more than thirty transmembrane domains and likely functions as part of mechanically-activated (MA) cation channels. These channels serve to connect mechanical forces to biological signals. The encoded protein quickly adapts MA currents in somatosensory neurons. Defects in this gene are a cause of type 5 distal arthrogryposis. Several alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Feb 2014]
Allele List at MGI
Other mutations in this stock
Total: 107 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430F08Rik T G 10: 100,583,958 D58A probably damaging Het
Abhd6 A T 14: 8,042,742 T100S probably benign Het
Adam6a T C 12: 113,545,378 I457T probably benign Het
Aff3 T C 1: 38,207,915 N863S probably benign Het
Agk C A 6: 40,376,234 D177E probably benign Het
Alg9 C T 9: 50,788,200 A209V probably damaging Het
Arl6 A T 16: 59,624,313 I51K probably damaging Het
Bpi A T 2: 158,261,352 H89L probably damaging Het
C1qtnf1 T A 11: 118,448,284 F260Y probably benign Het
Cblc T A 7: 19,784,822 D452V probably benign Het
Ccar1 T C 10: 62,776,694 T231A probably benign Het
Ccdc112 A G 18: 46,287,432 L417P probably damaging Het
Ccdc144b A T 3: 36,010,678 C515* probably null Het
Ccdc34 G A 2: 110,044,304 R336Q possibly damaging Het
CK137956 A G 4: 127,951,036 S305P probably benign Het
Clip2 T C 5: 134,503,115 D612G probably damaging Het
Col28a1 T C 6: 8,059,360 T692A probably benign Het
Copg2 A T 6: 30,816,741 probably null Het
Ctnna2 T A 6: 76,973,791 I566F possibly damaging Het
Cux2 C T 5: 121,861,326 D1184N probably benign Het
Dclk3 A G 9: 111,468,354 E322G probably benign Het
Ddx41 A T 13: 55,534,093 probably null Het
Dnaaf2 G A 12: 69,196,785 P107S probably damaging Het
Eif2ak4 A G 2: 118,430,947 E578G probably damaging Het
Exd1 A G 2: 119,528,663 probably benign Het
Fat2 G A 11: 55,282,757 P2377S probably damaging Het
Fbxl18 T C 5: 142,872,459 T741A probably benign Het
Fgr C A 4: 132,997,521 A311E probably damaging Het
Fmo4 T C 1: 162,798,889 T363A probably damaging Het
Fsbp T C 4: 11,584,006 V235A probably benign Het
Gm1110 T A 9: 26,894,258 H366L probably benign Het
Gm43302 T C 5: 105,290,980 N14S probably damaging Het
Gm5422 A G 10: 31,248,768 noncoding transcript Het
Gpr21 A G 2: 37,517,535 E31G probably damaging Het
Gucy1b2 G T 14: 62,408,758 N560K probably damaging Het
Hmcn1 T C 1: 150,677,334 Q2535R probably benign Het
Hnrnpm A T 17: 33,664,624 N264K probably damaging Het
Hyal6 A T 6: 24,734,724 I219L possibly damaging Het
Ifi211 A G 1: 173,907,603 S87P probably damaging Het
Il17rb A T 14: 29,996,840 C428* probably null Het
Iqca T C 1: 90,045,626 N808S probably benign Het
Kcnu1 A G 8: 25,918,442 I94V probably benign Het
Lrba A T 3: 86,310,017 E517V probably damaging Het
Mcidas A G 13: 112,993,981 E37G possibly damaging Het
Med23 T A 10: 24,879,755 F83L possibly damaging Het
Micu2 T C 14: 57,954,133 probably null Het
Mrgprx2 A T 7: 48,482,534 C179S probably damaging Het
Myo6 A G 9: 80,307,722 T1236A probably damaging Het
Myo7a A T 7: 98,054,708 V1946E possibly damaging Het
Nek10 A T 14: 14,885,122 Y695F probably damaging Het
Nr3c2 A T 8: 76,909,793 I508F possibly damaging Het
Olfr1056 A T 2: 86,356,186 H65Q possibly damaging Het
Olfr1133 A T 2: 87,645,889 I78N probably damaging Het
Olfr12 T C 1: 92,620,749 V281A probably benign Het
Olfr307 A T 7: 86,335,747 Y216* probably null Het
Olfr695 T C 7: 106,873,427 I273V probably benign Het
Olfr743 T C 14: 50,533,684 S91P probably damaging Het
Oxct1 T C 15: 4,153,761 S485P probably benign Het
Oxt A G 2: 130,576,652 D61G probably damaging Het
P2ry10 A C X: 107,102,635 I59L probably damaging Het
Parp11 A G 6: 127,477,891 N124S probably benign Het
Pcdh7 T A 5: 57,719,629 N175K probably damaging Het
Pdgfrb T A 18: 61,061,494 S114R probably benign Het
Pfdn5 A G 15: 102,326,521 N54S possibly damaging Het
Phc2 T A 4: 128,723,585 V468E probably benign Het
Pik3cb A T 9: 99,105,579 Y35* probably null Het
Piwil2 A T 14: 70,426,634 M22K probably damaging Het
Plag1 A G 4: 3,904,889 F101L probably damaging Het
Pomt2 A G 12: 87,111,399 L680P possibly damaging Het
Ppp1r36 A G 12: 76,418,926 probably null Het
Prkag2 C T 5: 24,871,054 probably null Het
Prkg1 T C 19: 31,664,142 D47G possibly damaging Het
Prl6a1 G A 13: 27,315,369 G45D probably benign Het
Rbm20 G A 19: 53,859,428 C1135Y probably damaging Het
Recql5 A T 11: 115,897,097 N465K probably benign Het
Rtcb A T 10: 85,941,933 I459N probably damaging Het
Rtp3 A T 9: 110,986,034 probably benign Het
Rundc3b T A 5: 8,512,409 probably null Het
Scube3 A G 17: 28,168,158 T877A probably damaging Het
Sh2d4a A T 8: 68,346,742 Q421L probably benign Het
Siglec1 A T 2: 131,083,357 Y395N probably damaging Het
Slc6a1 G T 6: 114,307,770 G263V probably damaging Het
Slco1c1 T A 6: 141,555,107 F437L probably benign Het
Slco3a1 G A 7: 74,346,671 A329V probably benign Het
Spag9 T A 11: 94,092,375 L504* probably null Het
Spen A T 4: 141,473,329 N2662K probably damaging Het
Sptb G C 12: 76,632,472 R70G possibly damaging Het
Stk3 A G 15: 35,072,498 S136P probably damaging Het
Synj1 A T 16: 90,938,696 F1456L probably damaging Het
Tbx5 T C 5: 119,841,906 probably null Het
Tchh G A 3: 93,446,961 R1236Q unknown Het
Timd4 C A 11: 46,820,030 T253K possibly damaging Het
Tmc6 A G 11: 117,769,406 Y669H probably damaging Het
Tmem151a C T 19: 5,082,938 R80H probably benign Het
Tpgs1 T C 10: 79,675,888 L288P probably damaging Het
Trhde T C 10: 114,498,793 I659V probably benign Het
Trpm7 A T 2: 126,823,997 Y896* probably null Het
Ttc5 C A 14: 50,781,550 E37* probably null Het
Uvrag A G 7: 98,939,889 probably null Het
Vmn1r59 T A 7: 5,454,284 D159V probably damaging Het
Vmn2r78 G A 7: 86,955,079 V822M possibly damaging Het
Vnn1 C A 10: 23,894,971 Y32* probably null Het
Wrn A G 8: 33,236,404 V1380A probably benign Het
Zc3h14 A C 12: 98,780,268 S579R possibly damaging Het
Zfp277 G A 12: 40,317,218 Q480* probably null Het
Zfp456 G A 13: 67,366,874 Q238* probably null Het
Zranb3 T A 1: 128,091,901 T35S probably benign Het
Other mutations in Piezo2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01360:Piezo2 APN 18 63117699 missense probably damaging 1.00
IGL01370:Piezo2 APN 18 63022460 missense probably damaging 1.00
IGL01543:Piezo2 APN 18 63070030 missense probably damaging 1.00
IGL01561:Piezo2 APN 18 63124614 missense probably benign 0.03
IGL01568:Piezo2 APN 18 63030392 missense probably benign 0.28
IGL01653:Piezo2 APN 18 63182833 splice site probably benign
IGL01674:Piezo2 APN 18 63027559 missense probably damaging 1.00
IGL01684:Piezo2 APN 18 63083170 missense probably damaging 1.00
IGL01744:Piezo2 APN 18 63042788 missense probably damaging 1.00
IGL01859:Piezo2 APN 18 63092844 missense probably benign 0.10
IGL02183:Piezo2 APN 18 63020634 missense probably benign 0.00
IGL02407:Piezo2 APN 18 63146844 missense probably damaging 1.00
IGL02441:Piezo2 APN 18 63072862 missense probably damaging 1.00
IGL02542:Piezo2 APN 18 63032924 missense probably damaging 0.96
IGL02652:Piezo2 APN 18 63024475 missense probably damaging 1.00
IGL02710:Piezo2 APN 18 63074659 missense probably damaging 1.00
IGL02850:Piezo2 APN 18 63020633 missense probably benign 0.18
IGL02851:Piezo2 APN 18 63020633 missense probably benign 0.18
IGL02972:Piezo2 APN 18 63064785 splice site probably benign
IGL03011:Piezo2 APN 18 63124660 missense probably benign 0.03
IGL03078:Piezo2 APN 18 63070075 missense probably damaging 1.00
IGL03114:Piezo2 APN 18 63030272 splice site probably null
IGL03129:Piezo2 APN 18 63114972 missense probably benign
IGL03143:Piezo2 APN 18 63108076 missense probably damaging 0.99
IGL03202:Piezo2 APN 18 63011598 missense probably damaging 1.00
IGL03227:Piezo2 APN 18 63124606 missense probably damaging 1.00
IGL03228:Piezo2 APN 18 63053062 missense probably damaging 1.00
IGL03230:Piezo2 APN 18 63041720 missense probably damaging 1.00
IGL03242:Piezo2 APN 18 63011538 utr 3 prime probably benign
IGL03291:Piezo2 APN 18 63021308 missense probably damaging 1.00
IGL03301:Piezo2 APN 18 63027704 missense probably damaging 1.00
Piccolo UTSW 18 63011696 missense probably damaging 1.00
P0023:Piezo2 UTSW 18 63386200 splice site probably benign
PIT4802001:Piezo2 UTSW 18 63024469 missense probably damaging 1.00
R0070:Piezo2 UTSW 18 63102084 missense probably damaging 1.00
R0416:Piezo2 UTSW 18 63024491 missense probably damaging 1.00
R0486:Piezo2 UTSW 18 63029061 missense probably damaging 1.00
R0498:Piezo2 UTSW 18 63102174 missense possibly damaging 0.87
R0504:Piezo2 UTSW 18 63024451 missense probably damaging 1.00
R0506:Piezo2 UTSW 18 63027544 missense probably damaging 1.00
R0523:Piezo2 UTSW 18 63022481 missense probably damaging 1.00
R0587:Piezo2 UTSW 18 63022426 missense possibly damaging 0.82
R0626:Piezo2 UTSW 18 63019258 missense probably damaging 0.97
R0734:Piezo2 UTSW 18 63041723 missense probably damaging 1.00
R0784:Piezo2 UTSW 18 63083235 missense probably damaging 1.00
R0973:Piezo2 UTSW 18 63015802 missense probably damaging 1.00
R1183:Piezo2 UTSW 18 63086753 missense probably damaging 1.00
R1344:Piezo2 UTSW 18 63021254 missense probably damaging 1.00
R1474:Piezo2 UTSW 18 63083131 missense probably damaging 1.00
R1571:Piezo2 UTSW 18 63144919 missense possibly damaging 0.67
R1643:Piezo2 UTSW 18 63082915 missense probably benign 0.03
R1649:Piezo2 UTSW 18 63117672 missense probably benign 0.34
R1741:Piezo2 UTSW 18 63021173 missense probably damaging 1.00
R1764:Piezo2 UTSW 18 63124642 missense possibly damaging 0.50
R1793:Piezo2 UTSW 18 63106284 missense possibly damaging 0.78
R1799:Piezo2 UTSW 18 63032840 critical splice donor site probably null
R1799:Piezo2 UTSW 18 63108087 missense probably damaging 1.00
R1868:Piezo2 UTSW 18 63019344 missense probably damaging 1.00
R1879:Piezo2 UTSW 18 63113960 missense probably damaging 1.00
R1962:Piezo2 UTSW 18 63078840 missense probably damaging 0.98
R1990:Piezo2 UTSW 18 63074662 missense probably null 1.00
R1991:Piezo2 UTSW 18 63074662 missense probably null 1.00
R1992:Piezo2 UTSW 18 63074662 missense probably null 1.00
R1995:Piezo2 UTSW 18 63078781 missense probably damaging 1.00
R2004:Piezo2 UTSW 18 63144926 missense probably damaging 1.00
R2029:Piezo2 UTSW 18 63118935 missense possibly damaging 0.62
R2075:Piezo2 UTSW 18 63081734 missense probably damaging 1.00
R2078:Piezo2 UTSW 18 63117720 missense probably damaging 0.99
R2152:Piezo2 UTSW 18 63114041 missense probably damaging 1.00
R2162:Piezo2 UTSW 18 63081662 critical splice donor site probably null
R2183:Piezo2 UTSW 18 63106274 missense probably damaging 1.00
R2230:Piezo2 UTSW 18 63145072 missense probably damaging 1.00
R2231:Piezo2 UTSW 18 63145072 missense probably damaging 1.00
R2406:Piezo2 UTSW 18 63022525 missense probably damaging 1.00
R2431:Piezo2 UTSW 18 63245624 missense possibly damaging 0.95
R2876:Piezo2 UTSW 18 63053035 missense probably damaging 1.00
R2935:Piezo2 UTSW 18 63146843 missense probably damaging 1.00
R3004:Piezo2 UTSW 18 63024435 nonsense probably null
R3016:Piezo2 UTSW 18 63042832 missense probably damaging 1.00
R3794:Piezo2 UTSW 18 63081793 missense probably damaging 0.99
R3832:Piezo2 UTSW 18 63081662 critical splice donor site probably null
R3833:Piezo2 UTSW 18 63081662 critical splice donor site probably null
R3968:Piezo2 UTSW 18 63011696 missense probably damaging 1.00
R3969:Piezo2 UTSW 18 63011696 missense probably damaging 1.00
R3970:Piezo2 UTSW 18 63011696 missense probably damaging 1.00
R4169:Piezo2 UTSW 18 63050604 missense probably benign
R4181:Piezo2 UTSW 18 63124730 critical splice acceptor site probably null
R4301:Piezo2 UTSW 18 63084840 missense probably damaging 1.00
R4302:Piezo2 UTSW 18 63124730 critical splice acceptor site probably null
R4475:Piezo2 UTSW 18 63102099 missense probably damaging 1.00
R4493:Piezo2 UTSW 18 63114063 missense probably damaging 0.98
R4519:Piezo2 UTSW 18 63072880 missense probably damaging 1.00
R4539:Piezo2 UTSW 18 63086628 missense probably damaging 1.00
R4687:Piezo2 UTSW 18 63069963 missense probably damaging 1.00
R4732:Piezo2 UTSW 18 63030401 missense probably damaging 1.00
R4733:Piezo2 UTSW 18 63030401 missense probably damaging 1.00
R4825:Piezo2 UTSW 18 63144954 missense probably damaging 0.98
R4899:Piezo2 UTSW 18 63078791 missense possibly damaging 0.84
R4946:Piezo2 UTSW 18 63157262 missense probably benign
R4961:Piezo2 UTSW 18 63052961 splice site probably null
R4968:Piezo2 UTSW 18 63144971 nonsense probably null
R4973:Piezo2 UTSW 18 63074680 missense probably damaging 1.00
R4997:Piezo2 UTSW 18 63083113 missense probably damaging 1.00
R5078:Piezo2 UTSW 18 63024536 missense probably damaging 1.00
R5134:Piezo2 UTSW 18 63074620 missense probably damaging 1.00
R5151:Piezo2 UTSW 18 63030409 missense possibly damaging 0.72
R5209:Piezo2 UTSW 18 63032929 missense probably damaging 1.00
R5367:Piezo2 UTSW 18 63064731 missense probably damaging 1.00
R5401:Piezo2 UTSW 18 63084740 missense possibly damaging 0.81
R5464:Piezo2 UTSW 18 63145105 missense probably damaging 1.00
R5469:Piezo2 UTSW 18 63027864 missense probably damaging 1.00
R5650:Piezo2 UTSW 18 63011721 missense probably damaging 1.00
R5654:Piezo2 UTSW 18 63145091 missense possibly damaging 0.94
R5677:Piezo2 UTSW 18 63117696 missense possibly damaging 0.94
R5677:Piezo2 UTSW 18 63117697 missense probably benign 0.25
R5792:Piezo2 UTSW 18 63146856 missense probably damaging 1.00
R5874:Piezo2 UTSW 18 63027901 missense probably damaging 1.00
R5877:Piezo2 UTSW 18 63113934 missense probably benign 0.22
R6036:Piezo2 UTSW 18 63114948 nonsense probably null
R6036:Piezo2 UTSW 18 63114948 nonsense probably null
R6073:Piezo2 UTSW 18 63012645 missense probably damaging 1.00
R6198:Piezo2 UTSW 18 63157210 nonsense probably null
R6255:Piezo2 UTSW 18 63121270 missense possibly damaging 0.75
R6259:Piezo2 UTSW 18 63117678 missense possibly damaging 0.69
R6391:Piezo2 UTSW 18 63106293 missense possibly damaging 0.79
R6446:Piezo2 UTSW 18 63086607 missense probably damaging 1.00
R6465:Piezo2 UTSW 18 63041663 missense possibly damaging 0.82
R6518:Piezo2 UTSW 18 63106271 missense probably damaging 0.99
R6521:Piezo2 UTSW 18 63021328 missense probably damaging 1.00
R6625:Piezo2 UTSW 18 63021262 missense probably damaging 1.00
R6744:Piezo2 UTSW 18 63032889 nonsense probably null
R6855:Piezo2 UTSW 18 63090879 critical splice donor site probably null
R6927:Piezo2 UTSW 18 63032986 missense probably damaging 1.00
R6980:Piezo2 UTSW 18 63082961 critical splice acceptor site probably null
R7141:Piezo2 UTSW 18 63145110 nonsense probably null
R7162:Piezo2 UTSW 18 63124709 missense possibly damaging 0.50
X0017:Piezo2 UTSW 18 63027586 missense probably damaging 0.99
X0022:Piezo2 UTSW 18 63050610 missense probably benign 0.43
X0060:Piezo2 UTSW 18 63017577 missense probably benign 0.09
Z1088:Piezo2 UTSW 18 63069994 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ATCTGGAGGCACCCTAGGTATC -3'
(R):5'- CCAAAGGAATATGTCTCCACAACTG -3'

Sequencing Primer
(F):5'- GCACCCTAGGTATCCCACGTC -3'
(R):5'- GAAGCTTAACTTAGGTCCATT -3'
Posted On2014-08-25