Incidental Mutation 'R0137:Scg3'
Institutional Source Beutler Lab
Gene Symbol Scg3
Ensembl Gene ENSMUSG00000032181
Gene Namesecretogranin III
SynonymsSgIII, Chgd, 1B1075
MMRRC Submission 038422-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.407) question?
Stock #R0137 (G1)
Quality Score225
Status Validated
Chromosomal Location75643189-75684056 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to T at 75663180 bp
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000034699] [ENSMUST00000213324]
Predicted Effect probably benign
Transcript: ENSMUST00000034699
SMART Domains Protein: ENSMUSP00000034699
Gene: ENSMUSG00000032181

Pfam:SGIII 20 471 1.3e-215 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194973
Predicted Effect probably benign
Transcript: ENSMUST00000213324
Predicted Effect probably benign
Transcript: ENSMUST00000215603
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 91.8%
Validation Efficiency 95% (94/99)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the chromogranin/secretogranin family of neuroendocrine secretory proteins. Granins may serve as precursors for biologically active peptides. Some granins have been shown to function as helper proteins in sorting and proteolytic processing of prohormones; however, the function of this protein is unknown. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous knockout causes dysregulation of the secretion of active peptide hormones from endocrine cells, exacerbating the adverse effects of inadequate diet (obesity, diabetes) and stress conditions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700092M07Rik A G 19: 8,740,857 probably benign Het
4931406P16Rik A T 7: 34,239,219 W246R probably damaging Het
6430548M08Rik A T 8: 120,151,376 H190L possibly damaging Het
Adap1 A G 5: 139,293,221 probably benign Het
Adgra3 C T 5: 49,963,840 probably benign Het
Adgre5 A T 8: 83,724,898 V527E probably damaging Het
Anapc5 A T 5: 122,800,632 Y360N probably damaging Het
Angptl6 C A 9: 20,878,387 A70S probably benign Het
Ankdd1a C A 9: 65,510,328 K137N probably null Het
Ccdc170 T C 10: 4,546,950 probably benign Het
Ccdc51 A G 9: 109,091,630 E195G probably damaging Het
Cdc37 A T 9: 21,142,130 C204S possibly damaging Het
Cfap36 T C 11: 29,222,431 probably benign Het
Col6a2 C A 10: 76,596,425 G965C probably damaging Het
Csn1s2a G A 5: 87,778,967 S53N possibly damaging Het
Dab2ip T C 2: 35,692,376 probably null Het
Dhx58 A G 11: 100,696,997 V578A probably damaging Het
Diaph1 G T 18: 37,891,849 Q520K unknown Het
Eefsec C A 6: 88,297,649 K444N probably benign Het
Eftud2 A T 11: 102,868,617 H153Q possibly damaging Het
Eif5b T G 1: 38,019,243 S209A probably benign Het
Exosc2 T A 2: 31,672,485 Y46N probably damaging Het
F2 C T 2: 91,625,730 G562D probably damaging Het
Fgf23 G A 6: 127,080,165 G148D probably damaging Het
Fmnl3 G C 15: 99,322,738 probably benign Het
Fstl5 G A 3: 76,707,479 G179R probably damaging Het
Gart T A 16: 91,625,394 Q745L probably benign Het
Gmeb1 T A 4: 132,232,108 M212L probably benign Het
Gpaa1 T C 15: 76,334,781 Y548H probably damaging Het
Gpatch1 T C 7: 35,287,242 E763G probably damaging Het
Grm8 T A 6: 27,762,390 I279F probably damaging Het
Hcls1 T A 16: 36,951,174 H147Q probably damaging Het
Hpcal1 A C 12: 17,786,388 D73A probably damaging Het
Il22ra1 T C 4: 135,751,006 S463P probably benign Het
Itgbl1 G A 14: 123,840,686 probably null Het
Izumo3 G T 4: 92,147,200 probably benign Het
Kcna5 A T 6: 126,533,383 L594Q probably damaging Het
Kif13a A T 13: 46,764,603 D409E probably benign Het
Kif9 A T 9: 110,485,038 I39F probably damaging Het
Klri2 C T 6: 129,732,208 R227H possibly damaging Het
Lamc3 G A 2: 31,908,616 G445S probably damaging Het
Lctl A G 9: 64,117,698 probably benign Het
Lrp4 T C 2: 91,494,982 L1384P probably damaging Het
Mcm9 G A 10: 53,563,430 S549L possibly damaging Het
Ms4a15 G A 19: 10,979,333 probably benign Het
Mtor T C 4: 148,470,624 V901A possibly damaging Het
Nckap1l A T 15: 103,481,964 I721F probably benign Het
Nemp2 T C 1: 52,645,429 V298A probably benign Het
Npc1l1 T A 11: 6,228,148 K421* probably null Het
Npr1 C T 3: 90,455,937 V879M probably damaging Het
Olfr1368 A G 13: 21,142,166 V297A possibly damaging Het
Olfr638 A G 7: 104,003,502 T82A probably benign Het
Osgin1 A T 8: 119,442,480 I39F possibly damaging Het
Phip G C 9: 82,927,191 probably null Het
Pkdrej G T 15: 85,821,567 P56Q possibly damaging Het
Plcxd2 A G 16: 45,980,526 Y112H probably damaging Het
Plekha1 C T 7: 130,897,446 T155M probably damaging Het
Prkdc T C 16: 15,740,332 probably null Het
Prss1 A G 6: 41,462,561 H76R probably damaging Het
Psg23 T C 7: 18,614,633 D83G probably benign Het
Ptprd T A 4: 76,136,903 Q196L probably benign Het
Ranbp3l A T 15: 9,062,987 H292L probably damaging Het
Ranbp6 T C 19: 29,809,697 E1085G probably benign Het
Rccd1 A G 7: 80,320,578 V97A possibly damaging Het
Rchy1 T C 5: 91,957,599 S48G probably benign Het
Rnmt G A 18: 68,313,700 M265I probably benign Het
Robo3 A T 9: 37,425,344 M376K probably benign Het
Rrp12 T C 19: 41,873,850 D898G probably benign Het
Sec31b A T 19: 44,534,382 M57K probably damaging Het
Slc17a6 A C 7: 51,666,144 I387L probably benign Het
Speer4a T A 5: 26,035,984 Q170L possibly damaging Het
Srsf9 A G 5: 115,332,201 D146G possibly damaging Het
Ss18 A G 18: 14,655,143 M90T probably damaging Het
Syna A T 5: 134,559,460 F212I possibly damaging Het
Thsd1 A G 8: 22,243,039 H34R probably damaging Het
Tmem143 T C 7: 45,897,662 I84T probably benign Het
Trim50 T C 5: 135,366,633 V281A probably damaging Het
Trp53i11 C A 2: 93,199,351 probably benign Het
Ttc25 A G 11: 100,563,568 E393G probably damaging Het
Ttll4 C T 1: 74,679,692 T234I possibly damaging Het
Ttyh1 A T 7: 4,124,720 I136F possibly damaging Het
Ube2f T C 1: 91,262,254 probably benign Het
Vcl T A 14: 20,987,015 L227* probably null Het
Vmn1r222 A C 13: 23,232,804 C80G probably damaging Het
Vps13b G T 15: 35,926,219 A3889S probably benign Het
Vps8 T C 16: 21,504,386 probably benign Het
Zbtb44 A G 9: 31,066,710 Y422C probably damaging Het
Zfp180 A G 7: 24,105,733 S526G possibly damaging Het
Zfp518a A C 19: 40,915,866 E1413A probably damaging Het
Zfp629 T A 7: 127,611,686 Y317F probably damaging Het
Zfp804b T C 5: 6,770,534 E843G probably benign Het
Other mutations in Scg3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Scg3 APN 9 75663237 missense probably damaging 1.00
IGL02221:Scg3 APN 9 75683657 missense probably damaging 0.99
IGL03391:Scg3 APN 9 75661251 critical splice donor site probably null
R0366:Scg3 UTSW 9 75675338 splice site probably benign
R0650:Scg3 UTSW 9 75669335 missense probably damaging 1.00
R0654:Scg3 UTSW 9 75665735 missense probably damaging 1.00
R0666:Scg3 UTSW 9 75643940 nonsense probably null
R0827:Scg3 UTSW 9 75683697 missense possibly damaging 0.81
R1317:Scg3 UTSW 9 75669340 missense probably damaging 1.00
R1553:Scg3 UTSW 9 75669304 missense probably null 1.00
R1751:Scg3 UTSW 9 75669340 missense probably damaging 1.00
R1761:Scg3 UTSW 9 75676758 missense probably damaging 1.00
R1850:Scg3 UTSW 9 75682167 missense possibly damaging 0.56
R2059:Scg3 UTSW 9 75665716 missense probably damaging 1.00
R2137:Scg3 UTSW 9 75676810 missense probably damaging 0.96
R2384:Scg3 UTSW 9 75665726 missense probably damaging 1.00
R3870:Scg3 UTSW 9 75675499 splice site probably benign
R4260:Scg3 UTSW 9 75651697 missense probably damaging 1.00
R5371:Scg3 UTSW 9 75661301 missense probably damaging 1.00
R5417:Scg3 UTSW 9 75669256 missense probably benign 0.02
R6013:Scg3 UTSW 9 75676808 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- ctcagcctataatcccagcac -3'
Posted On2013-04-12