Incidental Mutation 'R5417:Scg3'
ID427790
Institutional Source Beutler Lab
Gene Symbol Scg3
Ensembl Gene ENSMUSG00000032181
Gene Namesecretogranin III
SynonymsSgIII, Chgd, 1B1075
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5417 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location75643189-75684056 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 75669256 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 279 (Y279F)
Ref Sequence ENSEMBL: ENSMUSP00000149561 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034699] [ENSMUST00000213324]
Predicted Effect probably benign
Transcript: ENSMUST00000034699
AA Change: Y279F

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000034699
Gene: ENSMUSG00000032181
AA Change: Y279F

DomainStartEndE-ValueType
Pfam:SGIII 20 471 1.3e-215 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194973
Predicted Effect probably benign
Transcript: ENSMUST00000213324
AA Change: Y279F

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect probably benign
Transcript: ENSMUST00000215603
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the chromogranin/secretogranin family of neuroendocrine secretory proteins. Granins may serve as precursors for biologically active peptides. Some granins have been shown to function as helper proteins in sorting and proteolytic processing of prohormones; however, the function of this protein is unknown. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous knockout causes dysregulation of the secretion of active peptide hormones from endocrine cells, exacerbating the adverse effects of inadequate diet (obesity, diabetes) and stress conditions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap39 A G 15: 76,735,101 V761A possibly damaging Het
Ccdc47 C T 11: 106,210,350 R162Q probably benign Het
Cfap65 T C 1: 74,925,100 E563G probably damaging Het
Clec16a G A 16: 10,731,679 C872Y probably damaging Het
Col17a1 C A 19: 47,662,390 G732C probably damaging Het
Cped1 A G 6: 22,233,580 I812V probably null Het
Dennd1c CCGCCCCTCGCTGACAGC CC 17: 57,066,755 probably null Het
Dgkg A T 16: 22,588,331 M168K possibly damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dolpp1 T C 2: 30,396,237 L18P probably damaging Het
Eif3e A T 15: 43,265,521 D234E probably benign Het
Epha6 C A 16: 60,424,835 A334S possibly damaging Het
Fbxw10 G A 11: 62,877,164 R942Q possibly damaging Het
Flvcr2 T G 12: 85,747,191 F114V probably damaging Het
Gm14443 A T 2: 175,170,003 C217S probably damaging Het
Gphb5 A T 12: 75,412,972 V83E possibly damaging Het
Gpsm1 T C 2: 26,324,033 probably null Het
Grik4 A G 9: 42,671,248 F134S probably benign Het
Ibsp G A 5: 104,310,469 E291K possibly damaging Het
Igfals T G 17: 24,880,316 L127R probably damaging Het
Igsf9b CGGCCCCGGCCCAG CGGCCCCGGCCCAGGCCCCGGCCCAG 9: 27,334,276 probably benign Het
Iqcf3 T A 9: 106,554,214 D63V probably damaging Het
Klc4 A G 17: 46,632,031 probably null Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Mapk8ip2 C A 15: 89,457,439 D284E probably benign Het
Muc5b A T 7: 141,858,044 T1576S unknown Het
Nlrp3 G A 11: 59,549,063 G489S probably damaging Het
Nr5a1 T A 2: 38,708,086 Q233L possibly damaging Het
Nusap1 G A 2: 119,647,143 V345I probably damaging Het
Olfr1301 A G 2: 111,754,920 T224A possibly damaging Het
Olfr1494 A G 19: 13,749,853 H249R probably benign Het
Olfr612 A T 7: 103,538,763 V157E possibly damaging Het
Oxr1 A G 15: 41,820,371 T378A probably benign Het
Pcdhb12 T C 18: 37,436,034 F78L probably benign Het
Pgm2l1 A T 7: 100,272,376 I605L probably benign Het
Pik3c2g A G 6: 139,736,943 I17V probably benign Het
Prss39 A G 1: 34,500,128 S150G probably benign Het
Scara5 CG C 14: 65,759,662 probably null Het
Skiv2l C T 17: 34,846,598 V327I probably damaging Het
Srfbp1 T C 18: 52,488,625 C253R probably benign Het
Tcirg1 C T 19: 3,903,509 probably null Het
Trim37 A G 11: 87,166,679 Y313C probably damaging Het
Ttll9 A T 2: 153,002,992 M427L probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Tubgcp5 A G 7: 55,825,661 R932G possibly damaging Het
Other mutations in Scg3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Scg3 APN 9 75663237 missense probably damaging 1.00
IGL02221:Scg3 APN 9 75683657 missense probably damaging 0.99
IGL03391:Scg3 APN 9 75661251 critical splice donor site probably null
R0137:Scg3 UTSW 9 75663180 unclassified probably benign
R0366:Scg3 UTSW 9 75675338 splice site probably benign
R0650:Scg3 UTSW 9 75669335 missense probably damaging 1.00
R0654:Scg3 UTSW 9 75665735 missense probably damaging 1.00
R0666:Scg3 UTSW 9 75643940 nonsense probably null
R0827:Scg3 UTSW 9 75683697 missense possibly damaging 0.81
R1317:Scg3 UTSW 9 75669340 missense probably damaging 1.00
R1553:Scg3 UTSW 9 75669304 missense probably null 1.00
R1751:Scg3 UTSW 9 75669340 missense probably damaging 1.00
R1761:Scg3 UTSW 9 75676758 missense probably damaging 1.00
R1850:Scg3 UTSW 9 75682167 missense possibly damaging 0.56
R2059:Scg3 UTSW 9 75665716 missense probably damaging 1.00
R2137:Scg3 UTSW 9 75676810 missense probably damaging 0.96
R2384:Scg3 UTSW 9 75665726 missense probably damaging 1.00
R3870:Scg3 UTSW 9 75675499 splice site probably benign
R4260:Scg3 UTSW 9 75651697 missense probably damaging 1.00
R5371:Scg3 UTSW 9 75661301 missense probably damaging 1.00
R6013:Scg3 UTSW 9 75676808 missense probably damaging 1.00
R7052:Scg3 UTSW 9 75661382 nonsense probably null
R7202:Scg3 UTSW 9 75683710 missense probably benign 0.06
R7211:Scg3 UTSW 9 75682084 missense probably benign 0.00
R7471:Scg3 UTSW 9 75682092 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCCAGCCAACCGTACATG -3'
(R):5'- GACTTCACATTCAAGGTCACCAG -3'

Sequencing Primer
(F):5'- TACATGCCATGGAGGACTGC -3'
(R):5'- GAACTGGAAGTTGTGTTACTACTC -3'
Posted On2016-09-01