Incidental Mutation 'R3870:Scg3'
ID276518
Institutional Source Beutler Lab
Gene Symbol Scg3
Ensembl Gene ENSMUSG00000032181
Gene Namesecretogranin III
SynonymsSgIII, Chgd, 1B1075
MMRRC Submission 040789-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3870 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location75643189-75684056 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 75675499 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000034699] [ENSMUST00000213324]
Predicted Effect probably benign
Transcript: ENSMUST00000034699
SMART Domains Protein: ENSMUSP00000034699
Gene: ENSMUSG00000032181

DomainStartEndE-ValueType
Pfam:SGIII 20 471 1.3e-215 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213324
Predicted Effect probably benign
Transcript: ENSMUST00000215603
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 90% (61/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the chromogranin/secretogranin family of neuroendocrine secretory proteins. Granins may serve as precursors for biologically active peptides. Some granins have been shown to function as helper proteins in sorting and proteolytic processing of prohormones; however, the function of this protein is unknown. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous knockout causes dysregulation of the secretion of active peptide hormones from endocrine cells, exacerbating the adverse effects of inadequate diet (obesity, diabetes) and stress conditions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028J19Rik T A 7: 44,231,404 probably null Het
2410089E03Rik A T 15: 8,218,464 K1499M probably damaging Het
Adam22 C A 5: 8,132,418 C514F probably damaging Het
Akap8 G A 17: 32,317,839 probably benign Het
Armcx2 A T X: 134,806,299 V195E probably benign Het
Atg7 T C 6: 114,697,047 S301P possibly damaging Het
Cc2d2a C A 5: 43,718,691 Y1003* probably null Het
Ccdc93 A G 1: 121,463,114 S272G probably benign Het
Ces1d C G 8: 93,175,086 L418F probably benign Het
Cntnap5a A G 1: 116,060,249 E170G probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Ehd4 T A 2: 120,136,953 D120V probably damaging Het
Eif4g3 T A 4: 138,096,900 V71E probably damaging Het
Exoc5 A G 14: 49,019,396 probably benign Het
Glud1 T A 14: 34,325,580 probably benign Het
Gm10985 TTCTCTCTCTCTCTCTCT TTCTCTCTCTCTCTCT 3: 53,845,205 probably null Het
Gm11555 G T 11: 99,649,990 C64* probably null Het
Gm5468 A G 15: 25,414,475 probably benign Het
Gpatch2 T A 1: 187,322,294 L74Q probably damaging Het
Hnrnpa0 G A 13: 58,127,899 R139C probably damaging Het
Hrh1 A G 6: 114,480,919 Y387C probably damaging Het
Ldb3 A T 14: 34,567,483 D216E probably damaging Het
Lingo1 A T 9: 56,619,725 S533T probably benign Het
Lmtk2 T G 5: 144,166,427 probably benign Het
Map1s A G 8: 70,917,101 E939G possibly damaging Het
Mast1 G A 8: 84,918,731 T695I probably damaging Het
Mettl21e G A 1: 44,206,364 R241W probably benign Het
Mfsd4a G A 1: 132,046,353 T261I probably damaging Het
Mmel1 T C 4: 154,883,638 S144P probably benign Het
Myo16 A T 8: 10,442,239 H727L probably benign Het
Ncoa6 T C 2: 155,415,557 probably null Het
Nipa2 T C 7: 55,932,942 R352G probably damaging Het
Oaf C T 9: 43,222,758 R222Q probably benign Het
Olfr701 T A 7: 106,818,840 Y252* probably null Het
Pard3 T C 8: 127,409,686 S847P probably damaging Het
Pgbd1 C T 13: 21,434,370 R39H possibly damaging Het
Plcb1 A C 2: 135,325,671 I462L probably damaging Het
Prex2 T C 1: 11,160,192 V814A possibly damaging Het
Rasal3 G A 17: 32,393,548 R780W possibly damaging Het
Rubcnl C T 14: 75,040,916 P380L probably benign Het
Ryk A G 9: 102,891,228 E359G probably damaging Het
Sall2 C A 14: 52,313,994 L579F probably damaging Het
Satb2 A G 1: 56,891,220 S215P probably damaging Het
Slc35f5 A G 1: 125,562,361 T65A probably benign Het
Snx33 T C 9: 56,926,740 N15S probably benign Het
Stat2 T A 10: 128,277,893 S180R probably benign Het
Stxbp2 A G 8: 3,634,079 T129A probably damaging Het
Tas1r3 A T 4: 155,861,353 C529S probably damaging Het
Tlr12 T A 4: 128,616,568 M630L probably benign Het
Tnfrsf10b T G 14: 69,773,456 D103E probably benign Het
Togaram1 A C 12: 65,002,645 E1285D probably benign Het
Tppp A G 13: 74,030,772 T111A probably benign Het
Trim12c T C 7: 104,348,337 Q4R probably benign Het
Ttbk2 T G 2: 120,740,019 S1149R probably damaging Het
Uncx T C 5: 139,547,365 L395P probably damaging Het
Usp14 A G 18: 10,002,370 S314P possibly damaging Het
Usp32 A T 11: 85,007,055 Y1153* probably null Het
Vmn2r6 T C 3: 64,556,621 E264G probably damaging Het
Vmn2r77 T C 7: 86,811,842 F792S probably damaging Het
Vps13c A G 9: 67,884,726 I425V probably benign Het
Vstm4 C T 14: 32,863,755 A93V probably benign Het
Xrcc6 T A 15: 82,025,684 S97T probably benign Het
Zscan20 A G 4: 128,586,425 C758R probably damaging Het
Other mutations in Scg3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Scg3 APN 9 75663237 missense probably damaging 1.00
IGL02221:Scg3 APN 9 75683657 missense probably damaging 0.99
IGL03391:Scg3 APN 9 75661251 critical splice donor site probably null
R0137:Scg3 UTSW 9 75663180 unclassified probably benign
R0366:Scg3 UTSW 9 75675338 splice site probably benign
R0650:Scg3 UTSW 9 75669335 missense probably damaging 1.00
R0654:Scg3 UTSW 9 75665735 missense probably damaging 1.00
R0666:Scg3 UTSW 9 75643940 nonsense probably null
R0827:Scg3 UTSW 9 75683697 missense possibly damaging 0.81
R1317:Scg3 UTSW 9 75669340 missense probably damaging 1.00
R1553:Scg3 UTSW 9 75669304 missense probably null 1.00
R1751:Scg3 UTSW 9 75669340 missense probably damaging 1.00
R1761:Scg3 UTSW 9 75676758 missense probably damaging 1.00
R1850:Scg3 UTSW 9 75682167 missense possibly damaging 0.56
R2059:Scg3 UTSW 9 75665716 missense probably damaging 1.00
R2137:Scg3 UTSW 9 75676810 missense probably damaging 0.96
R2384:Scg3 UTSW 9 75665726 missense probably damaging 1.00
R4260:Scg3 UTSW 9 75651697 missense probably damaging 1.00
R5371:Scg3 UTSW 9 75661301 missense probably damaging 1.00
R5417:Scg3 UTSW 9 75669256 missense probably benign 0.02
R6013:Scg3 UTSW 9 75676808 missense probably damaging 1.00
R7052:Scg3 UTSW 9 75661382 nonsense probably null
R7202:Scg3 UTSW 9 75683710 missense probably benign 0.06
R7211:Scg3 UTSW 9 75682084 missense probably benign 0.00
R7471:Scg3 UTSW 9 75682092 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGCACCCATTCCTAACAC -3'
(R):5'- GGGTCACAGCCTACATAAGACAG -3'

Sequencing Primer
(F):5'- ACACATGTACATACCACTTTCTCTGG -3'
(R):5'- ACTGAGTAGCTAGGTTTCCAGCAC -3'
Posted On2015-04-06