Incidental Mutation 'R2013:Wdr33'
ID222463
Institutional Source Beutler Lab
Gene Symbol Wdr33
Ensembl Gene ENSMUSG00000024400
Gene NameWD repeat domain 33
Synonyms2810021O11Rik, 1110001N06Rik, 8430413N20Rik, 2310011G05Rik, WDC146
MMRRC Submission 040022-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.957) question?
Stock #R2013 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location31804057-31908987 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 31888976 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 860 (Q860K)
Ref Sequence ENSEMBL: ENSMUSP00000025264 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025264]
Predicted Effect unknown
Transcript: ENSMUST00000025264
AA Change: Q860K
SMART Domains Protein: ENSMUSP00000025264
Gene: ENSMUSG00000024400
AA Change: Q860K

DomainStartEndE-ValueType
WD40 107 147 2.15e-1 SMART
WD40 150 189 5.77e-5 SMART
WD40 191 230 1.89e-9 SMART
WD40 233 274 2.59e-7 SMART
WD40 277 316 2.73e-6 SMART
WD40 320 360 1.71e-7 SMART
WD40 364 403 1.52e-4 SMART
low complexity region 481 499 N/A INTRINSIC
coiled coil region 531 559 N/A INTRINSIC
low complexity region 573 587 N/A INTRINSIC
low complexity region 608 624 N/A INTRINSIC
low complexity region 628 668 N/A INTRINSIC
low complexity region 679 722 N/A INTRINSIC
low complexity region 725 761 N/A INTRINSIC
internal_repeat_1 778 803 3.47e-9 PROSPERO
low complexity region 806 818 N/A INTRINSIC
internal_repeat_1 821 845 3.47e-9 PROSPERO
low complexity region 848 881 N/A INTRINSIC
low complexity region 920 935 N/A INTRINSIC
low complexity region 938 951 N/A INTRINSIC
low complexity region 1000 1018 N/A INTRINSIC
low complexity region 1041 1049 N/A INTRINSIC
low complexity region 1057 1100 N/A INTRINSIC
low complexity region 1137 1154 N/A INTRINSIC
low complexity region 1190 1207 N/A INTRINSIC
low complexity region 1251 1262 N/A INTRINSIC
low complexity region 1287 1330 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. This gene is highly expressed in testis and the protein is localized to the nucleus. This gene may play important roles in the mechanisms of cytodifferentiation and/or DNA recombination. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik T A 5: 5,455,964 I106L probably benign Het
1700122O11Rik T G 17: 48,036,914 T194P possibly damaging Het
4921504E06Rik T A 2: 19,540,313 M110L probably benign Het
A830010M20Rik T C 5: 107,510,789 W1742R probably damaging Het
Acad9 T G 3: 36,073,588 I113R probably damaging Het
Adamts6 A T 13: 104,314,304 I332F probably damaging Het
Adcy8 C T 15: 64,767,878 G678S probably benign Het
Afg3l2 C T 18: 67,431,772 V211I probably damaging Het
Ahnak T C 19: 9,014,573 I4407T probably damaging Het
Alpl G T 4: 137,755,147 H79N probably benign Het
Apc A G 18: 34,315,591 I1813V probably damaging Het
Ascc3 T C 10: 50,649,812 M540T probably damaging Het
Blm T C 7: 80,502,399 E600G probably damaging Het
Cadps T A 14: 12,522,337 D609V probably damaging Het
Ccdc69 C T 11: 55,051,157 M174I probably benign Het
Cdk13 A T 13: 17,739,163 L877* probably null Het
Cdk14 T C 5: 5,093,047 Y228C probably damaging Het
Dip2c C T 13: 9,567,846 Q426* probably null Het
Dsp A G 13: 38,191,458 N1073S probably damaging Het
Epyc T C 10: 97,675,793 I216T probably damaging Het
Erbin A G 13: 103,857,533 S300P probably damaging Het
Ercc3 A G 18: 32,248,429 T433A probably benign Het
Exoc4 A G 6: 33,266,091 T80A probably damaging Het
Foxm1 T A 6: 128,375,502 probably null Het
Gaa A G 11: 119,284,583 probably null Het
Gm5346 T C 8: 43,626,405 S261G possibly damaging Het
H2-Q4 A G 17: 35,380,550 E203G probably damaging Het
Helt T C 8: 46,292,318 D214G probably damaging Het
Hlcs A G 16: 94,262,740 V487A probably benign Het
Hmmr A T 11: 40,728,432 S74T possibly damaging Het
Hspa9 A T 18: 34,946,648 Y243N probably damaging Het
Htt T G 5: 34,852,871 L1556R probably damaging Het
Ift80 T C 3: 68,990,784 K73E possibly damaging Het
Il6st G A 13: 112,498,889 A551T probably null Het
Kdm5a T C 6: 120,431,990 S1545P probably benign Het
Lef1 T A 3: 131,111,587 I39N probably damaging Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Lrp6 A G 6: 134,480,374 probably null Het
Macf1 T C 4: 123,684,014 D59G probably damaging Het
Maged1 T C X: 94,536,917 Y636C possibly damaging Het
Mamdc4 T A 2: 25,563,572 D1195V probably damaging Het
Mob3b A G 4: 35,083,922 V89A probably benign Het
Mogs C T 6: 83,117,650 R483* probably null Het
Mybphl A C 3: 108,375,402 T203P probably benign Het
Myo15 A G 11: 60,494,231 T1720A probably damaging Het
Myo16 T A 8: 10,502,796 F945I probably damaging Het
Nbeal2 G A 9: 110,634,071 L1309F probably benign Het
Nes A G 3: 87,976,678 Q748R possibly damaging Het
Nhsl1 A T 10: 18,511,592 R205W probably damaging Het
Nlrc3 A C 16: 3,965,110 L161R probably damaging Het
Npy2r T A 3: 82,541,180 D96V probably damaging Het
Olfr1143 T G 2: 87,802,503 V38G probably damaging Het
Olfr1423 T A 19: 12,036,154 E196V probably damaging Het
Papd5 T A 8: 88,245,595 probably null Het
Pappa2 C T 1: 158,834,928 C1159Y probably damaging Het
Phf21a T C 2: 92,228,483 probably null Het
Pik3c2a T A 7: 116,350,931 probably null Het
Psg22 A T 7: 18,719,635 Y85F possibly damaging Het
Qtrt2 A G 16: 43,869,092 I181T probably damaging Het
Sash1 A T 10: 8,729,413 V1071D probably benign Het
Scn10a A T 9: 119,613,736 I1481N probably damaging Het
Slc15a1 G A 14: 121,475,987 A376V possibly damaging Het
Slc25a46 A T 18: 31,609,725 H29Q probably benign Het
Slit2 T C 5: 48,302,490 C1354R probably damaging Het
Ssu2 C T 6: 112,383,941 E52K possibly damaging Het
Taar7e A T 10: 24,037,834 H74L possibly damaging Het
Tcte1 A T 17: 45,541,311 N490I probably benign Het
Tpst2 G T 5: 112,308,014 G140C probably damaging Het
Trip11 A T 12: 101,837,722 F1634I probably damaging Het
Trpm2 A G 10: 77,925,766 F1017L probably damaging Het
Utp18 A G 11: 93,876,122 V253A possibly damaging Het
Vmn2r102 A G 17: 19,676,744 T118A probably benign Het
Vmn2r14 T C 5: 109,221,243 T155A probably benign Het
Vmn2r19 T A 6: 123,315,995 M332K probably benign Het
Vmn2r71 T A 7: 85,620,637 M452K probably benign Het
Vmn2r79 T G 7: 87,004,081 L518R possibly damaging Het
Vps13b T C 15: 35,607,142 S1074P probably damaging Het
Vps13d A G 4: 145,108,508 S2757P probably damaging Het
Zfp423 T A 8: 87,782,397 I440F probably benign Het
Zufsp A G 10: 33,929,824 V437A possibly damaging Het
Other mutations in Wdr33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00737:Wdr33 APN 18 31878116 missense probably damaging 1.00
IGL01099:Wdr33 APN 18 31906789 unclassified probably benign
IGL01628:Wdr33 APN 18 31888310 missense unknown
IGL03296:Wdr33 APN 18 31827391 missense probably benign 0.03
R0103:Wdr33 UTSW 18 31833335 missense probably damaging 1.00
R0279:Wdr33 UTSW 18 31888324 missense unknown
R0563:Wdr33 UTSW 18 31886739 missense possibly damaging 0.94
R0730:Wdr33 UTSW 18 31835376 splice site probably benign
R1077:Wdr33 UTSW 18 31835461 missense probably benign 0.03
R1377:Wdr33 UTSW 18 31888641 missense unknown
R1712:Wdr33 UTSW 18 31896631 missense unknown
R1855:Wdr33 UTSW 18 31906856 unclassified probably benign
R2014:Wdr33 UTSW 18 31833599 missense probably damaging 1.00
R4497:Wdr33 UTSW 18 31893079 missense unknown
R4727:Wdr33 UTSW 18 31888447 missense unknown
R4739:Wdr33 UTSW 18 31886086 missense probably benign 0.17
R4777:Wdr33 UTSW 18 31881248 missense probably damaging 1.00
R4907:Wdr33 UTSW 18 31906993 makesense probably null
R5811:Wdr33 UTSW 18 31902620 missense unknown
R6053:Wdr33 UTSW 18 31878063 missense possibly damaging 0.93
R6454:Wdr33 UTSW 18 31829975 missense possibly damaging 0.47
R7112:Wdr33 UTSW 18 31893003 missense unknown
R7369:Wdr33 UTSW 18 31886666 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGGTTAATGATTGGCCACCC -3'
(R):5'- CCCACGTGTTAATATGCACAAGC -3'

Sequencing Primer
(F):5'- GTTAATGATTGGCCACCCACCTC -3'
(R):5'- ATTGGCCCTTGAGATGGA -3'
Posted On2014-08-25