Incidental Mutation 'R2073:Duox2'
ID227306
Institutional Source Beutler Lab
Gene Symbol Duox2
Ensembl Gene ENSMUSG00000068452
Gene Namedual oxidase 2
SynonymsA430065P05Rik
MMRRC Submission 040078-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2073 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location122279247-122298165 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 122295158 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 323 (S323C)
Ref Sequence ENSEMBL: ENSMUSP00000050314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028656] [ENSMUST00000053734]
Predicted Effect probably benign
Transcript: ENSMUST00000028656
SMART Domains Protein: ENSMUSP00000028656
Gene: ENSMUSG00000027225

DomainStartEndE-ValueType
Pfam:DuoxA 10 286 5.5e-114 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000053734
AA Change: S323C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000050314
Gene: ENSMUSG00000068452
AA Change: S323C

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:An_peroxidase 35 560 5e-131 PFAM
transmembrane domain 600 622 N/A INTRINSIC
EFh 823 851 3.7e-5 SMART
EFh 859 887 2.09e-4 SMART
transmembrane domain 1010 1032 N/A INTRINSIC
Pfam:Ferric_reduct 1053 1202 1.8e-22 PFAM
Pfam:FAD_binding_8 1238 1340 3.1e-20 PFAM
Pfam:NAD_binding_6 1346 1500 1.5e-33 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a glycoprotein and a member of the NADPH oxidase family. The synthesis of thyroid hormone is catalyzed by a protein complex located at the apical membrane of thyroid follicular cells. This complex contains an iodide transporter, thyroperoxidase, and a peroxide generating system that includes this encoded protein and DUOX1. This protein is known as dual oxidase because it has both a peroxidase homology domain and a gp91phox domain. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a spontaneous mutation fail to breed and are congenitally hypothyroid (low T4, high TSH), dwarf, and hearing impaired. Anterior pituitaries are dysplastic. Cochlear defects include delayed formation of the inner sulcus and tunnel of Corti and a thickened tectorial membrane. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik A G 4: 41,507,519 probably null Het
2310057M21Rik T C 7: 131,357,513 R153G probably benign Het
4930430A15Rik T C 2: 111,200,418 E382G probably damaging Het
5730596B20Rik C A 6: 52,178,982 Y9* probably null Het
9130011E15Rik A T 19: 45,965,381 I188K probably damaging Het
Aco1 G A 4: 40,183,605 G508S probably damaging Het
Acot3 A G 12: 84,053,456 H2R possibly damaging Het
Adamts13 T A 2: 27,006,314 C1240S probably damaging Het
Adra1b T C 11: 43,835,871 N73S probably damaging Het
Aebp2 G A 6: 140,633,694 S219N probably benign Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Ank T C 15: 27,565,022 S270P probably benign Het
Ankle1 G A 8: 71,409,329 R492H possibly damaging Het
Ankub1 G A 3: 57,692,292 H19Y possibly damaging Het
Anln C A 9: 22,333,168 W1083L probably benign Het
Apaf1 G T 10: 91,031,694 S763* probably null Het
Apba3 A G 10: 81,269,294 T134A probably benign Het
Bod1l C T 5: 41,819,189 S1594N probably benign Het
C7 T C 15: 4,990,428 M746V probably benign Het
Cdkn2a T A 4: 89,294,493 I11F possibly damaging Het
Cideb T C 14: 55,755,160 M100V possibly damaging Het
Cntnap5c T C 17: 58,305,552 L862P possibly damaging Het
Coch A T 12: 51,602,689 D261V probably benign Het
Cyp2ab1 A G 16: 20,313,889 F220L possibly damaging Het
Ddx10 A T 9: 53,240,505 D73E probably benign Het
Dgkg A G 16: 22,565,317 F462S probably damaging Het
Dlgap3 C T 4: 127,195,366 H252Y probably damaging Het
Dmd G C X: 84,312,483 A2257P probably benign Het
Dtnb A G 12: 3,781,273 T658A probably benign Het
Dync1h1 T A 12: 110,614,592 I251N probably damaging Het
Eml5 A G 12: 98,802,446 S1457P probably damaging Het
Fam114a1 T A 5: 64,995,904 probably null Het
Fcho1 A T 8: 71,710,489 L632Q probably damaging Het
Gm12695 T C 4: 96,723,945 Y527C possibly damaging Het
Gm16223 T C 5: 42,214,599 C111R unknown Het
H2-Q4 T A 17: 35,380,402 S154T possibly damaging Het
Hhat A G 1: 192,727,379 F125L possibly damaging Het
Ier5l T A 2: 30,473,056 D319V probably damaging Het
Kif5a T C 10: 127,245,369 D232G probably damaging Het
M1ap A G 6: 82,981,882 I165V probably benign Het
Map2k4 A C 11: 65,693,456 F334V probably damaging Het
Mmp19 G A 10: 128,794,979 R156H probably damaging Het
Mpped2 T A 2: 106,744,802 Y77* probably null Het
Nhs T A X: 161,842,721 H544L probably damaging Het
Nr4a1 C A 15: 101,274,067 H541N probably damaging Het
Olfr1247 A G 2: 89,609,478 V208A probably benign Het
Olfr1484 A T 19: 13,585,601 Q99L probably damaging Het
Pak6 A C 2: 118,688,851 N17T probably damaging Het
Pcnt T A 10: 76,380,380 T2225S possibly damaging Het
Pdzd2 A G 15: 12,385,819 L955P probably damaging Het
Phf21a A G 2: 92,348,036 D357G probably damaging Het
Pih1d3 A G 1: 31,222,996 S20G probably benign Het
Pkhd1l1 G T 15: 44,558,639 A3102S probably damaging Het
Plch2 A T 4: 154,989,909 L754Q probably damaging Het
Plekhd1 A G 12: 80,721,292 N335D probably benign Het
Pole C A 5: 110,325,551 T1737N probably damaging Het
Pramel6 G A 2: 87,508,744 S96N probably damaging Het
Prdm14 A C 1: 13,125,730 Y36D possibly damaging Het
Psg27 T C 7: 18,560,417 D355G probably damaging Het
Rfc1 A T 5: 65,301,939 D225E probably damaging Het
Sec16a A G 2: 26,440,239 I588T probably damaging Het
Setd6 G A 8: 95,716,788 V60M probably damaging Het
Sgk3 A G 1: 9,891,424 I432V probably benign Het
Six2 A G 17: 85,687,505 S150P probably damaging Het
Slc1a6 T C 10: 78,800,130 V343A possibly damaging Het
Slc43a3 T C 2: 84,944,612 probably null Het
Smc3 A G 19: 53,631,533 D620G probably benign Het
Smg6 C G 11: 74,930,294 P464A probably damaging Het
Sox11 T C 12: 27,342,279 T44A possibly damaging Het
Spata22 A G 11: 73,336,226 R89G possibly damaging Het
Stk3 T C 15: 34,959,049 M256V possibly damaging Het
Syne2 A G 12: 76,015,579 D4226G possibly damaging Het
Tecpr2 T C 12: 110,968,429 S1370P possibly damaging Het
Tek A G 4: 94,827,729 I463V probably benign Het
Trib1 T A 15: 59,654,340 I253N probably damaging Het
Triobp G T 15: 78,973,895 G1232V probably damaging Het
Trpm6 G A 19: 18,876,042 V1809M probably damaging Het
Tsc22d4 A G 5: 137,762,487 K57E possibly damaging Het
Vmn2r109 T A 17: 20,564,712 K15N probably benign Het
Wdr78 G A 4: 103,050,193 T632M probably damaging Het
Wnt9a A G 11: 59,331,229 N318D probably damaging Het
Wwp1 A G 4: 19,662,181 V138A possibly damaging Het
Zfp37 A T 4: 62,191,708 M411K probably damaging Het
Zfp715 T A 7: 43,311,120 T16S probably benign Het
Zfp932 A G 5: 110,009,818 T461A possibly damaging Het
Zscan29 A T 2: 121,160,855 C817* probably null Het
Other mutations in Duox2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00474:Duox2 APN 2 122283575 missense probably benign
IGL00790:Duox2 APN 2 122292300 missense possibly damaging 0.63
IGL01346:Duox2 APN 2 122287202 splice site probably benign
IGL01607:Duox2 APN 2 122292319 missense probably benign 0.00
IGL01798:Duox2 APN 2 122281908 missense probably damaging 1.00
IGL02000:Duox2 APN 2 122290709 missense probably benign
IGL02219:Duox2 APN 2 122294664 missense probably benign 0.01
IGL02227:Duox2 APN 2 122285153 splice site probably benign
IGL02276:Duox2 APN 2 122294085 missense probably benign 0.00
IGL02447:Duox2 APN 2 122297468 missense probably damaging 0.98
IGL02806:Duox2 APN 2 122284666 missense probably damaging 1.00
IGL03091:Duox2 APN 2 122289474 missense probably benign 0.03
Bedazzled UTSW 2 122287121 missense possibly damaging 0.76
Immunox UTSW 2 122281871 missense probably benign
minor UTSW 2 122281496 missense probably damaging 1.00
paltry UTSW 2 122283060 critical splice donor site probably null
Recruit UTSW 2 122283897 missense possibly damaging 0.83
stumblebum UTSW 2 122284667 missense probably damaging 1.00
Two-bit UTSW 2 122281002 missense probably benign 0.42
R0049:Duox2 UTSW 2 122296686 missense possibly damaging 0.48
R0244:Duox2 UTSW 2 122291860 missense probably benign 0.00
R0281:Duox2 UTSW 2 122292304 missense probably benign 0.10
R0378:Duox2 UTSW 2 122284583 missense probably benign 0.00
R0383:Duox2 UTSW 2 122291810 critical splice donor site probably null
R0442:Duox2 UTSW 2 122289332 missense probably benign 0.08
R0524:Duox2 UTSW 2 122281836 missense possibly damaging 0.80
R0560:Duox2 UTSW 2 122291554 missense probably benign 0.04
R0562:Duox2 UTSW 2 122289599 missense probably damaging 1.00
R0645:Duox2 UTSW 2 122292658 missense probably damaging 1.00
R0704:Duox2 UTSW 2 122284768 missense probably benign 0.01
R0963:Duox2 UTSW 2 122287172 missense probably benign 0.03
R1254:Duox2 UTSW 2 122283478 missense probably damaging 1.00
R1442:Duox2 UTSW 2 122281751 missense probably benign 0.20
R1473:Duox2 UTSW 2 122287121 missense possibly damaging 0.76
R1489:Duox2 UTSW 2 122293396 missense probably benign
R1738:Duox2 UTSW 2 122293414 missense probably damaging 1.00
R1748:Duox2 UTSW 2 122287051 missense probably benign 0.00
R1809:Duox2 UTSW 2 122283897 missense possibly damaging 0.83
R1843:Duox2 UTSW 2 122292258 critical splice donor site probably null
R1903:Duox2 UTSW 2 122295351 missense probably damaging 1.00
R1962:Duox2 UTSW 2 122297372 splice site probably null
R2069:Duox2 UTSW 2 122287108 missense probably benign 0.01
R2074:Duox2 UTSW 2 122295158 missense probably damaging 1.00
R2075:Duox2 UTSW 2 122295158 missense probably damaging 1.00
R2085:Duox2 UTSW 2 122280967 missense probably damaging 1.00
R3123:Duox2 UTSW 2 122281073 splice site probably benign
R3907:Duox2 UTSW 2 122283060 critical splice donor site probably null
R4572:Duox2 UTSW 2 122281726 missense probably benign 0.00
R4614:Duox2 UTSW 2 122289557 missense probably damaging 1.00
R4675:Duox2 UTSW 2 122280933 missense probably damaging 1.00
R4770:Duox2 UTSW 2 122284916 missense probably benign 0.01
R4817:Duox2 UTSW 2 122296515 missense probably damaging 0.98
R4931:Duox2 UTSW 2 122296755 missense probably benign 0.01
R5138:Duox2 UTSW 2 122297531 missense probably damaging 1.00
R5288:Duox2 UTSW 2 122295136 missense probably benign
R5344:Duox2 UTSW 2 122281871 missense probably benign
R5385:Duox2 UTSW 2 122295136 missense probably benign
R5386:Duox2 UTSW 2 122295136 missense probably benign
R5493:Duox2 UTSW 2 122281496 missense probably damaging 1.00
R5632:Duox2 UTSW 2 122281455 missense probably damaging 1.00
R5742:Duox2 UTSW 2 122284921 missense probably benign 0.00
R6228:Duox2 UTSW 2 122287193 missense probably benign 0.38
R6380:Duox2 UTSW 2 122281002 missense probably benign 0.42
R6398:Duox2 UTSW 2 122296370 missense probably benign 0.06
R6409:Duox2 UTSW 2 122284667 missense probably damaging 1.00
R6527:Duox2 UTSW 2 122294614 missense probably benign 0.29
R6596:Duox2 UTSW 2 122285338 missense probably benign
R6719:Duox2 UTSW 2 122284386 intron probably null
R6981:Duox2 UTSW 2 122291227 missense possibly damaging 0.95
R7036:Duox2 UTSW 2 122280453 missense probably damaging 1.00
R7073:Duox2 UTSW 2 122289307 missense probably damaging 1.00
R7105:Duox2 UTSW 2 122289552 missense possibly damaging 0.93
R7127:Duox2 UTSW 2 122291949 missense probably benign 0.02
R7259:Duox2 UTSW 2 122295176 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GATTTCCTATGGATCCCAAACTTCC -3'
(R):5'- GCTTCCTGCAGAAAACTCCTC -3'

Sequencing Primer
(F):5'- GCTTCTCTTCTGAATGAAACTGGAG -3'
(R):5'- CTCCTCCAGAGTATTCAGGTAATGG -3'
Posted On2014-09-17