Incidental Mutation 'R2090:Skp2'
ID231733
Institutional Source Beutler Lab
Gene Symbol Skp2
Ensembl Gene ENSMUSG00000054115
Gene NameS-phase kinase-associated protein 2 (p45)
SynonymsFBXL1
MMRRC Submission 040095-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2090 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location9111985-9155425 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 9113698 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Cysteine at position 376 (G376C)
Ref Sequence ENSEMBL: ENSMUSP00000139997 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067760] [ENSMUST00000096482] [ENSMUST00000100789] [ENSMUST00000100790] [ENSMUST00000110585] [ENSMUST00000190131]
Predicted Effect probably benign
Transcript: ENSMUST00000067760
SMART Domains Protein: ENSMUSP00000068318
Gene: ENSMUSG00000022253

DomainStartEndE-ValueType
low complexity region 13 33 N/A INTRINSIC
Pfam:NAD_kinase 58 334 4.7e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000096482
AA Change: G411C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000094225
Gene: ENSMUSG00000054115
AA Change: G411C

DomainStartEndE-ValueType
FBOX 100 140 3.7e-8 SMART
LRR 205 229 1.27e2 SMART
LRR 230 254 1.28e1 SMART
LRR 255 280 2.91e1 SMART
LRR 334 359 2.83e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100789
SMART Domains Protein: ENSMUSP00000098353
Gene: ENSMUSG00000022253

DomainStartEndE-ValueType
low complexity region 13 33 N/A INTRINSIC
Pfam:NAD_kinase 58 171 8.2e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100790
SMART Domains Protein: ENSMUSP00000098354
Gene: ENSMUSG00000022253

DomainStartEndE-ValueType
low complexity region 13 33 N/A INTRINSIC
Pfam:NAD_kinase 58 312 3.9e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110585
SMART Domains Protein: ENSMUSP00000106215
Gene: ENSMUSG00000054115

DomainStartEndE-ValueType
FBOX 100 140 3.7e-8 SMART
Blast:LRR 205 229 5e-7 BLAST
Blast:LRR 229 253 3e-7 BLAST
Blast:LRR 255 284 3e-10 BLAST
Blast:LRR 309 334 3e-8 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189437
Predicted Effect probably damaging
Transcript: ENSMUST00000190131
AA Change: G376C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139997
Gene: ENSMUSG00000054115
AA Change: G376C

DomainStartEndE-ValueType
FBOX 65 105 2.3e-10 SMART
LRR 170 194 5.3e-1 SMART
LRR 195 219 5.3e-2 SMART
LRR 220 245 1.2e-1 SMART
LRR 299 324 1.2e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190591
Meta Mutation Damage Score 0.34 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbls class; in addition to an F-box, this protein contains 10 tandem leucine-rich repeats. This protein is an essential element of the cyclin A-CDK2 S-phase kinase. It specifically recognizes phosphorylated cyclin-dependent kinase inhibitor 1B (CDKN1B, also referred to as p27 or KIP1) predominantly in S phase and interacts with S-phase kinase-associated protein 1 (SKP1 or p19). In addition, this gene is established as a protooncogene causally involved in the pathogenesis of lymphomas. Alternative splicing of this gene generates three transcript variants encoding different isoforms. [provided by RefSeq, Jul 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced body weight, enlarged cell and nuclear sizes, polyploidy, reduced cell growth rate, overduplication of centrosomes, increased apoptosis rate, delayed wound healing, and aberrant immunoglobulin V(D)J recombination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik A G 5: 24,550,676 S283P probably benign Het
Adam32 A G 8: 24,901,440 probably null Het
Adcy7 A T 8: 88,315,857 T451S probably damaging Het
Adgrg3 A T 8: 95,039,930 T410S possibly damaging Het
Alg11 G T 8: 22,065,630 L302F possibly damaging Het
Ankrd17 A G 5: 90,298,046 V310A possibly damaging Het
Atg16l2 C T 7: 101,293,368 probably null Het
AY761184 A T 8: 21,702,789 W64R possibly damaging Het
B3gnt2 A G 11: 22,836,291 V299A probably benign Het
Birc6 A G 17: 74,662,796 N4258S probably benign Het
C2cd4d A G 3: 94,364,014 K196E probably benign Het
Cdr2l A G 11: 115,391,001 K111E probably damaging Het
Crtam T C 9: 40,984,316 Q41R possibly damaging Het
Cspp1 A G 1: 10,090,268 K560R possibly damaging Het
Dcaf15 A T 8: 84,097,771 Y571* probably null Het
Dpy19l4 T C 4: 11,304,344 Y99C probably benign Het
Edem3 C T 1: 151,804,826 probably benign Het
Enpp6 A T 8: 47,065,370 probably null Het
Fam26f A G 10: 34,126,362 S242P probably damaging Het
Foxf2 T A 13: 31,626,841 D254E probably benign Het
Gjb5 T C 4: 127,356,001 N117D probably benign Het
Glmn G A 5: 107,561,928 L337F probably damaging Het
Gsdmc2 T A 15: 63,826,826 Y307F probably benign Het
Gsdmc3 T A 15: 63,866,782 M144L probably benign Het
Ibtk A G 9: 85,720,993 I653T probably benign Het
Il24 T G 1: 130,884,837 D99A possibly damaging Het
Intu A G 3: 40,683,536 Q484R probably benign Het
Lsp1 T C 7: 142,491,807 probably benign Het
Mad1l1 A G 5: 140,009,256 S672P probably benign Het
Man2a2 A T 7: 80,364,110 probably benign Het
Morc3 C A 16: 93,866,453 H515N probably benign Het
Nav1 T C 1: 135,607,165 probably benign Het
Ndor1 A G 2: 25,249,218 L247P probably damaging Het
Nfkbiz A T 16: 55,816,455 F494L probably benign Het
Nr1d1 G A 11: 98,770,610 P277S probably damaging Het
Nrg2 T C 18: 36,018,443 D682G probably benign Het
Nrros C T 16: 32,144,157 W311* probably null Het
Oasl1 G A 5: 114,935,934 D301N probably damaging Het
Olfr1118 A T 2: 87,309,418 I230F probably benign Het
Olfr196 A G 16: 59,168,140 M1T probably null Het
Olfr304 A T 7: 86,386,081 I193N probably benign Het
Palmd A G 3: 116,927,434 S123P probably damaging Het
Patj A G 4: 98,437,323 probably benign Het
Pcsk4 T C 10: 80,325,821 D162G probably benign Het
Plppr5 A G 3: 117,575,871 D59G possibly damaging Het
Pmvk A C 3: 89,461,882 R11S possibly damaging Het
Pnliprp1 A G 19: 58,740,469 T363A probably benign Het
Poll A T 19: 45,558,838 I65N probably benign Het
Prox1 T A 1: 190,160,812 S479C probably damaging Het
Prss50 A T 9: 110,862,293 S222C probably damaging Het
Rasa3 A C 8: 13,582,381 probably benign Het
Sec14l3 T C 11: 4,075,481 V335A probably benign Het
Setbp1 C T 18: 78,856,720 S1244N probably benign Het
Sgcg A T 14: 61,245,764 F63I probably damaging Het
Slc2a13 T A 15: 91,516,492 I176F probably benign Het
Smc6 A G 12: 11,289,986 T432A probably benign Het
Snx25 G A 8: 46,056,113 P478L probably damaging Het
Taf2 A T 15: 55,016,486 H1151Q probably damaging Het
Thsd1 A G 8: 22,259,657 K795R possibly damaging Het
Tmem108 G A 9: 103,484,777 L537F possibly damaging Het
Ubr3 T C 2: 69,936,017 Y410H probably damaging Het
Vav3 T C 3: 109,647,739 probably null Het
Vmn1r224 T C 17: 20,419,262 Y34H probably benign Het
Zeb1 T C 18: 5,766,458 V323A possibly damaging Het
Zfp652 A G 11: 95,754,008 D240G probably benign Het
Zfp963 A T 8: 69,743,346 C152* probably null Het
Other mutations in Skp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00841:Skp2 APN 15 9139487 missense probably benign 0.00
IGL02135:Skp2 APN 15 9125147 missense probably benign
R0050:Skp2 UTSW 15 9125091 missense probably benign 0.03
R0129:Skp2 UTSW 15 9125193 missense probably damaging 1.00
R0238:Skp2 UTSW 15 9127884 critical splice donor site probably null
R0238:Skp2 UTSW 15 9127884 critical splice donor site probably null
R1404:Skp2 UTSW 15 9116925 nonsense probably null
R1404:Skp2 UTSW 15 9116925 nonsense probably null
R1503:Skp2 UTSW 15 9127911 missense probably damaging 1.00
R1660:Skp2 UTSW 15 9125114 missense probably benign 0.03
R1746:Skp2 UTSW 15 9139443 missense possibly damaging 0.58
R2031:Skp2 UTSW 15 9113698 missense probably damaging 1.00
R2034:Skp2 UTSW 15 9113698 missense probably damaging 1.00
R2087:Skp2 UTSW 15 9113698 missense probably damaging 1.00
R2088:Skp2 UTSW 15 9113698 missense probably damaging 1.00
R2091:Skp2 UTSW 15 9113698 missense probably damaging 1.00
R4272:Skp2 UTSW 15 9116860 critical splice donor site probably null
R4428:Skp2 UTSW 15 9116947 missense probably benign 0.21
R4747:Skp2 UTSW 15 9113839 missense possibly damaging 0.93
R5734:Skp2 UTSW 15 9139479 missense possibly damaging 0.85
R6963:Skp2 UTSW 15 9139428 splice site probably null
Predicted Primers PCR Primer
(F):5'- CCTCGCAAATGGTTCCCTAAC -3'
(R):5'- TAGTCTGACAACTGCCATACC -3'

Sequencing Primer
(F):5'- CATACATATAAAGTGAAGGCTAAGGC -3'
(R):5'- AACTGCCATACCTCCTGGAATTTG -3'
Posted On2014-09-18