Incidental Mutation 'R2152:Fgfr4'
ID234428
Institutional Source Beutler Lab
Gene Symbol Fgfr4
Ensembl Gene ENSMUSG00000005320
Gene Namefibroblast growth factor receptor 4
SynonymsFgfr-4
MMRRC Submission 040155-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2152 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location55152640-55168759 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 55166964 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 640 (Y640F)
Ref Sequence ENSEMBL: ENSMUSP00000005452 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005452]
Predicted Effect probably damaging
Transcript: ENSMUST00000005452
AA Change: Y640F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000005452
Gene: ENSMUSG00000005320
AA Change: Y640F

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
IGc2 45 105 1.39e-11 SMART
IGc2 160 228 3.1e-18 SMART
IGc2 259 337 1.59e-6 SMART
low complexity region 369 387 N/A INTRINSIC
low complexity region 416 446 N/A INTRINSIC
TyrKc 464 740 1.67e-148 SMART
low complexity region 764 795 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the fibroblast growth factor receptor family, where amino acid sequence is highly conserved between members and throughout evolution. FGFR family members differ from one another in their ligand affinities and tissue distribution. A full-length representative protein would consist of an extracellular region, composed of three immunoglobulin-like domains, a single hydrophobic membrane-spanning segment and a cytoplasmic tyrosine kinase domain. The extracellular portion of the protein interacts with fibroblast growth factors, setting in motion a cascade of downstream signals, ultimately influencing mitogenesis and differentiation. The genomic organization of this gene, compared to members 1-3, encompasses 18 exons rather than 19 or 20. Although alternative splicing has been observed, there is no evidence that the C-terminal half of the IgIII domain of this protein varies between three alternate forms, as indicated for members 1-3. This particular family member preferentially binds acidic fibroblast growth factor and, although its specific function is unknown, it is overexpressed in gynecological tumor samples, suggesting a role in breast and ovarian tumorigenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted mutation are viable, healthy and overtly normal, except for a 10% weight reduction at weaning. Mice doubly homozygous for disruptions of Fgfr3 and Fgfr4 show novel phenotypes not seen in either single mutant, including dwarfismand defective respiratory alveogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik T A 17: 33,066,934 D298V probably damaging Het
Ackr3 A T 1: 90,213,843 Y8F probably benign Het
Acy1 T C 9: 106,435,617 E175G probably damaging Het
Add2 T C 6: 86,098,598 L243P probably damaging Het
Adsl A G 15: 80,967,662 D407G probably damaging Het
Afg3l1 T G 8: 123,494,836 I478S probably damaging Het
Arfrp1 T C 2: 181,359,694 T108A probably benign Het
Art5 A G 7: 102,098,200 L124P possibly damaging Het
Asap2 A T 12: 21,112,083 T14S probably damaging Het
Atp2c2 A G 8: 119,756,102 N901S probably benign Het
Bbs12 G T 3: 37,321,160 E586* probably null Het
Bicd2 G T 13: 49,379,576 C546F probably damaging Het
Bid A T 6: 120,900,254 L42Q probably damaging Het
Bpifb9a A G 2: 154,260,135 K51E probably benign Het
Calcr G T 6: 3,687,615 T424K probably benign Het
Cd46 A G 1: 195,062,413 I339T probably benign Het
Chek1 C A 9: 36,723,983 V35F probably damaging Het
Cntn3 A G 6: 102,206,537 I719T probably damaging Het
Cyb5r1 T C 1: 134,409,625 I163T possibly damaging Het
Cyp2d26 A T 15: 82,792,706 probably null Het
Dclk1 A G 3: 55,247,212 Y21C probably damaging Het
Dgcr2 G A 16: 17,891,487 probably null Het
Dhx38 T C 8: 109,560,674 S221G probably benign Het
Dis3l T A 9: 64,307,263 N981I probably benign Het
Dnah3 C T 7: 119,952,013 V3028I probably benign Het
Dnah6 T C 6: 73,049,166 Y3448C probably benign Het
Dok5 G A 2: 170,800,896 G38D probably damaging Het
Doxl2 T A 6: 48,976,539 I466N probably damaging Het
Epb41l1 A G 2: 156,514,128 D528G probably damaging Het
Fat4 A T 3: 38,983,395 Y3732F probably damaging Het
Foxo6 T A 4: 120,268,614 D328V probably benign Het
Foxp1 A G 6: 99,016,541 L134P probably damaging Het
Frem2 G A 3: 53,517,029 R2996* probably null Het
Fuk T A 8: 110,889,072 T542S probably benign Het
Garem2 T C 5: 30,108,299 S54P probably damaging Het
Gcn1l1 T A 5: 115,609,829 I1765N probably benign Het
Gm4787 T A 12: 81,377,219 I722F probably benign Het
Gpc6 G T 14: 116,926,092 A53S probably benign Het
Gtpbp8 A G 16: 44,740,027 probably null Het
H2-Q2 T C 17: 35,345,276 probably null Het
Hapln2 C A 3: 88,023,613 R157L probably benign Het
Hemgn C A 4: 46,396,607 E210* probably null Het
Hpse T A 5: 100,691,403 K360* probably null Het
Iqcj A T 3: 68,055,310 E68V probably damaging Het
Kat2a T C 11: 100,712,346 probably benign Het
Kat6b A T 14: 21,668,667 H1138L probably benign Het
Kcnab1 A T 3: 65,371,440 I371F probably damaging Het
Klhl30 C A 1: 91,357,824 A356D probably benign Het
Klra3 G C 6: 130,333,144 R138G probably benign Het
Mgea5 A T 19: 45,758,022 Y779* probably null Het
Micu1 G T 10: 59,863,288 M468I probably benign Het
Mrc1 A G 2: 14,327,864 T1292A probably damaging Het
Myh8 G A 11: 67,294,469 E849K probably damaging Het
Myom3 G T 4: 135,803,233 R1152L probably benign Het
Nedd4l T A 18: 65,210,330 H820Q probably damaging Het
Nlrp4g T A 9: 124,353,339 noncoding transcript Het
Olfr1339 C T 4: 118,735,249 A240V possibly damaging Het
Olfr1413 T C 1: 92,573,908 S246P probably damaging Het
Olfr24 T C 9: 18,755,095 D180G probably damaging Het
Olfr33 G T 7: 102,713,581 H277Q probably benign Het
Olfr435 A G 6: 43,202,069 I142V probably benign Het
Olfr592 A T 7: 103,186,640 D13V probably benign Het
Olfr913 G T 9: 38,594,411 L63F probably damaging Het
Olfr969 A T 9: 39,795,647 I91F probably benign Het
Otop1 T A 5: 38,302,851 M587K probably damaging Het
Pgm5 T A 19: 24,834,815 I118F probably damaging Het
Phc2 A G 4: 128,745,066 *41W probably null Het
Piezo2 A T 18: 63,114,041 M532K probably damaging Het
Pjvk A T 2: 76,658,369 I295F probably benign Het
Popdc2 A G 16: 38,363,120 N155S possibly damaging Het
Ppp4r3a G T 12: 101,042,567 N684K probably damaging Het
Prpf4b T A 13: 34,900,419 M930K probably benign Het
Ptpn12 C A 5: 21,002,468 Q297H probably damaging Het
Ptprz1 C A 6: 23,030,671 L1010I probably damaging Het
Rabepk A T 2: 34,784,550 D232E possibly damaging Het
Rad51ap2 A G 12: 11,457,985 H636R probably benign Het
Rb1 T C 14: 73,288,725 T169A probably benign Het
Rcc2 T C 4: 140,717,117 L373P probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rrbp1 A G 2: 143,954,198 L1200P possibly damaging Het
Sdk1 A G 5: 141,792,944 N226D probably damaging Het
Selenbp1 G A 3: 94,944,130 R398H probably damaging Het
Selenoo A G 15: 89,099,282 M509V probably benign Het
Sidt2 T C 9: 45,945,340 D477G probably damaging Het
Slc2a5 T G 4: 150,125,638 S27A probably damaging Het
Slc30a5 A T 13: 100,803,949 H619Q probably damaging Het
Slc5a9 A G 4: 111,893,223 I146T possibly damaging Het
Slc6a1 G T 6: 114,307,770 G263V probably damaging Het
Slmap A G 14: 26,418,247 Y771H probably damaging Het
Snx29 A G 16: 11,400,843 D181G possibly damaging Het
Spata31d1c G A 13: 65,033,965 probably null Het
Stat5a C A 11: 100,874,090 T213N probably benign Het
Stt3a A T 9: 36,747,996 V349D probably damaging Het
Tcf20 A T 15: 82,855,602 D549E probably damaging Het
Thbs2 T A 17: 14,673,209 D903V probably damaging Het
Tln2 T C 9: 67,302,560 T432A probably damaging Het
Tmc1 A T 19: 20,856,675 N241K probably benign Het
Tmem260 G T 14: 48,477,609 R240L possibly damaging Het
Tnfaip6 A T 2: 52,043,730 E32D probably damaging Het
Trpa1 A T 1: 14,899,401 H381Q probably damaging Het
Tsen2 T C 6: 115,547,975 I45T possibly damaging Het
Ttc6 G A 12: 57,705,552 V1415I probably damaging Het
Ttll7 G T 3: 146,930,189 R426L probably damaging Het
Ttn A C 2: 76,740,138 S26804A probably damaging Het
Ubqlnl A T 7: 104,148,683 C536S probably benign Het
Vmn2r73 A G 7: 85,857,728 V792A probably benign Het
Zfp345 T C 2: 150,472,658 T320A probably benign Het
Zfp407 T C 18: 84,209,649 D1945G possibly damaging Het
Other mutations in Fgfr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Fgfr4 APN 13 55159170 missense probably damaging 0.99
IGL02140:Fgfr4 APN 13 55161179 missense probably benign
IGL02817:Fgfr4 APN 13 55156668 critical splice donor site probably null
Modest UTSW 13 55166251 missense probably damaging 1.00
R0153:Fgfr4 UTSW 13 55161385 splice site probably benign
R0727:Fgfr4 UTSW 13 55156228 splice site probably null
R1646:Fgfr4 UTSW 13 55165964 missense probably damaging 1.00
R1749:Fgfr4 UTSW 13 55167792 splice site probably null
R1993:Fgfr4 UTSW 13 55165902 missense probably damaging 1.00
R2037:Fgfr4 UTSW 13 55167889 missense possibly damaging 0.51
R2386:Fgfr4 UTSW 13 55167901 missense probably benign 0.36
R3086:Fgfr4 UTSW 13 55167392 splice site probably benign
R3939:Fgfr4 UTSW 13 55156494 missense probably null 0.96
R4255:Fgfr4 UTSW 13 55166251 missense probably damaging 1.00
R4463:Fgfr4 UTSW 13 55156467 missense probably benign 0.02
R4510:Fgfr4 UTSW 13 55161515 missense possibly damaging 0.81
R4511:Fgfr4 UTSW 13 55161515 missense possibly damaging 0.81
R4852:Fgfr4 UTSW 13 55161156 missense possibly damaging 0.68
R4932:Fgfr4 UTSW 13 55168170 missense unknown
R5133:Fgfr4 UTSW 13 55160015 missense probably damaging 1.00
R5146:Fgfr4 UTSW 13 55165912 missense probably damaging 1.00
R5380:Fgfr4 UTSW 13 55167417 missense probably damaging 1.00
R5431:Fgfr4 UTSW 13 55156651 missense probably benign
R5927:Fgfr4 UTSW 13 55166887 missense probably damaging 1.00
R6318:Fgfr4 UTSW 13 55166108 missense probably damaging 1.00
R6792:Fgfr4 UTSW 13 55156898 missense possibly damaging 0.65
R7018:Fgfr4 UTSW 13 55166200 missense probably damaging 0.98
R7290:Fgfr4 UTSW 13 55161449 missense probably benign 0.00
R7343:Fgfr4 UTSW 13 55159155 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTTGCTGTGAAATGATCAAC -3'
(R):5'- GCAGCCATCTTAGAACCCATTTC -3'

Sequencing Primer
(F):5'- CTTGCTGTGAAATGATCAACTCCCAG -3'
(R):5'- AGACTCACACGTCACTCTGGTG -3'
Posted On2014-10-01