Incidental Mutation 'R2162:Sptan1'
ID 235186
Institutional Source Beutler Lab
Gene Symbol Sptan1
Ensembl Gene ENSMUSG00000057738
Gene Name spectrin alpha, non-erythrocytic 1
Synonyms alpha-fodrin, alphaII-spectrin, Spna2, 2610027H02Rik, Spna-2
MMRRC Submission 040165-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2162 (G1)
Quality Score 206
Status Validated
Chromosome 2
Chromosomal Location 29855572-29921463 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) T to C at 29908588 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121116 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046257] [ENSMUST00000095083] [ENSMUST00000100225] [ENSMUST00000113717] [ENSMUST00000113719] [ENSMUST00000129241]
AlphaFold P16546
Predicted Effect probably benign
Transcript: ENSMUST00000046257
SMART Domains Protein: ENSMUSP00000047792
Gene: ENSMUSG00000057738

DomainStartEndE-ValueType
SPEC 47 146 2.1e-30 SMART
SPEC 152 252 2.6e-35 SMART
SPEC 258 358 4.93e-36 SMART
SPEC 364 464 1.08e-27 SMART
SPEC 470 570 9.01e-30 SMART
SPEC 576 675 3.52e-32 SMART
SPEC 681 781 2.15e-36 SMART
SPEC 787 887 2.45e-40 SMART
SPEC 893 1068 1.18e-24 SMART
SH3 970 1025 8.24e-18 SMART
SPEC 1074 1210 6.52e-27 SMART
SPEC 1216 1316 1.44e-37 SMART
SPEC 1322 1422 4.43e-29 SMART
SPEC 1428 1528 7.54e-32 SMART
SPEC 1534 1635 9.65e-30 SMART
SPEC 1641 1741 2.32e-32 SMART
SPEC 1747 1847 6.98e-36 SMART
SPEC 1853 1953 1.53e-32 SMART
SPEC 1959 2060 6.23e-24 SMART
SPEC 2074 2174 2.08e-11 SMART
SPEC 2188 2289 1.07e-4 SMART
EFh 2307 2335 5.78e-7 SMART
EFh 2350 2378 3.85e-3 SMART
efhand_Ca_insen 2382 2451 6.74e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095083
SMART Domains Protein: ENSMUSP00000092697
Gene: ENSMUSG00000057738

DomainStartEndE-ValueType
SPEC 47 146 2.1e-30 SMART
SPEC 152 252 2.6e-35 SMART
SPEC 258 358 4.93e-36 SMART
SPEC 364 464 1.08e-27 SMART
SPEC 470 570 9.01e-30 SMART
SPEC 576 675 3.52e-32 SMART
SPEC 681 781 2.15e-36 SMART
SPEC 787 887 2.45e-40 SMART
SPEC 893 1088 1.56e-24 SMART
SH3 970 1025 8.24e-18 SMART
SPEC 1094 1230 6.52e-27 SMART
SPEC 1236 1336 1.44e-37 SMART
SPEC 1342 1442 4.43e-29 SMART
SPEC 1448 1548 7.54e-32 SMART
SPEC 1554 1655 9.65e-30 SMART
SPEC 1661 1761 2.32e-32 SMART
SPEC 1767 1867 6.98e-36 SMART
SPEC 1873 1973 1.53e-32 SMART
SPEC 1979 2080 6.23e-24 SMART
SPEC 2094 2194 2.08e-11 SMART
SPEC 2208 2309 1.07e-4 SMART
EFh 2327 2355 5.78e-7 SMART
EFh 2370 2398 3.85e-3 SMART
efhand_Ca_insen 2402 2471 6.74e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100225
SMART Domains Protein: ENSMUSP00000097797
Gene: ENSMUSG00000057738

DomainStartEndE-ValueType
SPEC 47 146 2.1e-30 SMART
SPEC 152 252 2.6e-35 SMART
SPEC 258 358 4.93e-36 SMART
SPEC 364 464 1.08e-27 SMART
SPEC 470 570 9.01e-30 SMART
SPEC 576 675 3.52e-32 SMART
SPEC 681 781 2.15e-36 SMART
SPEC 787 887 2.45e-40 SMART
SPEC 893 1088 1.56e-24 SMART
SH3 970 1025 8.24e-18 SMART
SPEC 1094 1230 6.52e-27 SMART
SPEC 1236 1336 1.44e-37 SMART
SPEC 1342 1442 4.43e-29 SMART
SPEC 1448 1548 7.54e-32 SMART
SPEC 1554 1660 2.06e-24 SMART
SPEC 1666 1766 2.32e-32 SMART
SPEC 1772 1872 6.98e-36 SMART
SPEC 1878 1978 1.53e-32 SMART
SPEC 1984 2085 6.23e-24 SMART
SPEC 2099 2199 2.08e-11 SMART
SPEC 2213 2314 1.07e-4 SMART
EFh 2332 2360 5.78e-7 SMART
EFh 2375 2403 3.85e-3 SMART
efhand_Ca_insen 2407 2476 6.74e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113717
SMART Domains Protein: ENSMUSP00000109346
Gene: ENSMUSG00000057738

DomainStartEndE-ValueType
SPEC 47 146 2.1e-30 SMART
SPEC 152 252 2.6e-35 SMART
SPEC 258 358 4.93e-36 SMART
SPEC 364 464 1.08e-27 SMART
SPEC 470 570 9.01e-30 SMART
SPEC 576 675 3.52e-32 SMART
SPEC 681 781 2.15e-36 SMART
SPEC 787 887 2.45e-40 SMART
SPEC 893 1068 1.18e-24 SMART
SH3 970 1025 8.24e-18 SMART
SPEC 1074 1210 6.52e-27 SMART
SPEC 1216 1316 1.44e-37 SMART
SPEC 1322 1422 4.43e-29 SMART
SPEC 1428 1528 7.54e-32 SMART
SPEC 1534 1640 2.06e-24 SMART
SPEC 1646 1746 2.32e-32 SMART
SPEC 1752 1852 6.98e-36 SMART
SPEC 1858 1958 1.53e-32 SMART
SPEC 1964 2065 6.23e-24 SMART
SPEC 2079 2179 2.08e-11 SMART
SPEC 2193 2294 1.07e-4 SMART
EFh 2312 2340 5.78e-7 SMART
EFh 2355 2383 3.85e-3 SMART
efhand_Ca_insen 2387 2456 6.74e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113719
SMART Domains Protein: ENSMUSP00000109348
Gene: ENSMUSG00000057738

DomainStartEndE-ValueType
SPEC 47 146 2.1e-30 SMART
SPEC 152 252 2.6e-35 SMART
SPEC 258 358 4.93e-36 SMART
SPEC 364 464 1.08e-27 SMART
SPEC 470 570 9.01e-30 SMART
SPEC 576 675 3.52e-32 SMART
SPEC 681 781 2.15e-36 SMART
SPEC 787 887 2.45e-40 SMART
SPEC 893 1068 1.18e-24 SMART
SH3 970 1025 8.24e-18 SMART
SPEC 1074 1210 6.52e-27 SMART
SPEC 1216 1316 1.44e-37 SMART
SPEC 1322 1422 4.43e-29 SMART
SPEC 1428 1528 7.54e-32 SMART
SPEC 1534 1640 2.06e-24 SMART
SPEC 1646 1746 2.32e-32 SMART
SPEC 1752 1852 6.98e-36 SMART
SPEC 1858 1958 1.53e-32 SMART
SPEC 1964 2065 6.23e-24 SMART
SPEC 2079 2179 2.08e-11 SMART
SPEC 2193 2315 3.27e0 SMART
EFh 2333 2361 5.78e-7 SMART
EFh 2376 2404 3.85e-3 SMART
efhand_Ca_insen 2408 2477 6.74e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129241
SMART Domains Protein: ENSMUSP00000121116
Gene: ENSMUSG00000057738

DomainStartEndE-ValueType
Pfam:Spectrin 1 65 9.9e-10 PFAM
SPEC 78 178 2.08e-11 SMART
SPEC 192 314 3.27e0 SMART
EFh 332 360 5.78e-7 SMART
EFh 375 403 3.85e-3 SMART
efhand_Ca_insen 407 476 6.74e-32 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149846
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrins are a family of filamentous cytoskeletal proteins that function as essential scaffold proteins that stabilize the plasma membrane and organize intracellular organelles. Spectrins are composed of alpha and beta dimers that associate to form tetramers linked in a head-to-head arrangement. This gene encodes an alpha spectrin that is specifically expressed in nonerythrocytic cells. The encoded protein has been implicated in other cellular functions including DNA repair and cell cycle regulation. Mutations in this gene are the cause of early infantile epileptic encephalopathy-5. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Sep 2010]
PHENOTYPE: Homozygous deletion of the exons encoding the CCC region are normal. Mice homozygous for a gene trap allele exhibit embryonic lethality and abnormal nervous system, heart and craniofacial morphology. [provided by MGI curators]
Allele List at MGI

All alleles(76) : Targeted(1) Gene trapped(75)

Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts20 A C 15: 94,229,339 (GRCm39) C927G probably damaging Het
Afdn T A 17: 14,116,436 (GRCm39) D190E probably benign Het
Ankrd28 T C 14: 31,430,719 (GRCm39) D850G probably damaging Het
Arhgap45 T C 10: 79,852,813 (GRCm39) M1T probably null Het
Atp6v0a4 T G 6: 38,065,581 (GRCm39) K128N possibly damaging Het
Bcat1 T A 6: 144,955,834 (GRCm39) D349V probably damaging Het
Cacna1i T C 15: 80,240,388 (GRCm39) F370S probably damaging Het
Clca4b T C 3: 144,634,348 (GRCm39) I82V probably benign Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,604,632 (GRCm39) probably null Het
Cyfip2 T C 11: 46,152,333 (GRCm39) D485G probably benign Het
Cyp27b1 G T 10: 126,886,929 (GRCm39) V382L probably damaging Het
Dnaaf5 T C 5: 139,167,320 (GRCm39) V447A possibly damaging Het
Dpp9 A T 17: 56,506,113 (GRCm39) F429I possibly damaging Het
Eng C T 2: 32,569,059 (GRCm39) R528C probably damaging Het
Gcn1 A T 5: 115,730,191 (GRCm39) Q835L probably benign Het
Gprc6a CAAA CA 10: 51,491,776 (GRCm39) probably null Het
Hlx T A 1: 184,462,889 (GRCm39) probably null Het
Htt T A 5: 34,979,062 (GRCm39) V815D probably benign Het
Il36rn G T 2: 24,169,692 (GRCm39) L17F probably damaging Het
Itga1 C T 13: 115,167,446 (GRCm39) V157I probably benign Het
Krtap19-3 T G 16: 88,674,607 (GRCm39) *88C probably null Het
Lzic G C 4: 149,573,185 (GRCm39) E112D probably null Het
Mark2 G C 19: 7,260,112 (GRCm39) S111C probably damaging Het
Mep1b C T 18: 21,219,296 (GRCm39) T150I possibly damaging Het
Mroh7 G C 4: 106,557,378 (GRCm39) S777R probably damaging Het
Nrxn1 G A 17: 90,469,859 (GRCm39) R35C probably damaging Het
Or12e10 T A 2: 87,640,704 (GRCm39) I180K probably damaging Het
Or51v8 T G 7: 103,320,079 (GRCm39) Q53P possibly damaging Het
Or5p69 C A 7: 107,966,769 (GRCm39) P24Q probably benign Het
Pacs2 A G 12: 113,014,567 (GRCm39) T243A probably benign Het
Pan2 A G 10: 128,140,091 (GRCm39) E4G possibly damaging Het
Pdp1 A G 4: 11,961,123 (GRCm39) V396A probably damaging Het
Pdzd7 A G 19: 45,024,494 (GRCm39) probably null Het
Peg10 T A 6: 4,755,914 (GRCm39) probably benign Het
Pgc C A 17: 48,040,236 (GRCm39) F93L probably null Het
Piezo2 A G 18: 63,214,733 (GRCm39) probably null Het
Pja2 T C 17: 64,616,397 (GRCm39) D166G probably benign Het
Ppp1r9b T C 11: 94,888,877 (GRCm39) L97P probably damaging Het
Ptgir A G 7: 16,640,794 (GRCm39) M29V possibly damaging Het
S100a10 T C 3: 93,471,680 (GRCm39) V88A probably damaging Het
Scn9a T A 2: 66,364,573 (GRCm39) Y789F probably damaging Het
Slit3 A T 11: 35,579,509 (GRCm39) S1229C probably null Het
Spata31g1 A G 4: 42,972,238 (GRCm39) T524A possibly damaging Het
Srrd G T 5: 112,490,810 (GRCm39) probably benign Het
Tdrd3 A G 14: 87,718,221 (GRCm39) T201A probably damaging Het
Tectb C G 19: 55,169,431 (GRCm39) probably benign Het
Ttll4 A G 1: 74,725,550 (GRCm39) K653E probably damaging Het
Usp43 A G 11: 67,770,795 (GRCm39) L613P probably damaging Het
Vmn1r167 T C 7: 23,204,224 (GRCm39) D264G possibly damaging Het
Whamm A G 7: 81,221,089 (GRCm39) D7G probably damaging Het
Zcchc17 T C 4: 130,232,317 (GRCm39) D62G probably benign Het
Zfp280d T A 9: 72,206,104 (GRCm39) I62K probably damaging Het
Zfp445 T G 9: 122,681,541 (GRCm39) E800A probably damaging Het
Zfp516 A G 18: 83,005,063 (GRCm39) R656G possibly damaging Het
Other mutations in Sptan1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00668:Sptan1 APN 2 29,883,968 (GRCm39) critical splice donor site probably null
IGL00932:Sptan1 APN 2 29,905,622 (GRCm39) missense probably damaging 1.00
IGL00945:Sptan1 APN 2 29,890,083 (GRCm39) splice site probably benign
IGL01070:Sptan1 APN 2 29,904,185 (GRCm39) critical splice donor site probably null
IGL01625:Sptan1 APN 2 29,916,126 (GRCm39) missense probably damaging 1.00
IGL01657:Sptan1 APN 2 29,908,491 (GRCm39) missense probably benign 0.12
IGL01795:Sptan1 APN 2 29,908,501 (GRCm39) missense probably benign 0.07
IGL01982:Sptan1 APN 2 29,909,980 (GRCm39) missense probably damaging 1.00
IGL02040:Sptan1 APN 2 29,903,725 (GRCm39) missense probably benign 0.43
IGL02158:Sptan1 APN 2 29,920,336 (GRCm39) missense probably damaging 0.97
IGL02370:Sptan1 APN 2 29,920,752 (GRCm39) missense probably damaging 0.99
IGL02507:Sptan1 APN 2 29,906,067 (GRCm39) missense probably damaging 1.00
IGL02552:Sptan1 APN 2 29,908,486 (GRCm39) missense probably damaging 0.99
IGL02690:Sptan1 APN 2 29,888,195 (GRCm39) missense possibly damaging 0.78
IGL02715:Sptan1 APN 2 29,868,588 (GRCm39) missense probably benign 0.03
IGL02725:Sptan1 APN 2 29,886,055 (GRCm39) missense probably damaging 0.99
IGL03033:Sptan1 APN 2 29,881,045 (GRCm39) missense probably damaging 1.00
IGL03304:Sptan1 APN 2 29,876,505 (GRCm39) missense probably damaging 1.00
IGL03405:Sptan1 APN 2 29,915,593 (GRCm39) missense probably damaging 0.99
R0058:Sptan1 UTSW 2 29,883,708 (GRCm39) splice site probably null
R0058:Sptan1 UTSW 2 29,883,708 (GRCm39) splice site probably null
R0066:Sptan1 UTSW 2 29,893,679 (GRCm39) splice site probably benign
R0066:Sptan1 UTSW 2 29,893,679 (GRCm39) splice site probably benign
R0071:Sptan1 UTSW 2 29,893,354 (GRCm39) nonsense probably null
R0071:Sptan1 UTSW 2 29,893,354 (GRCm39) nonsense probably null
R0094:Sptan1 UTSW 2 29,896,635 (GRCm39) missense probably benign 0.37
R0230:Sptan1 UTSW 2 29,900,704 (GRCm39) splice site probably benign
R0242:Sptan1 UTSW 2 29,908,413 (GRCm39) missense probably benign 0.00
R0242:Sptan1 UTSW 2 29,908,413 (GRCm39) missense probably benign 0.00
R0366:Sptan1 UTSW 2 29,882,764 (GRCm39) splice site probably null
R0368:Sptan1 UTSW 2 29,883,927 (GRCm39) missense probably benign 0.29
R0396:Sptan1 UTSW 2 29,881,045 (GRCm39) missense probably damaging 1.00
R0423:Sptan1 UTSW 2 29,918,684 (GRCm39) missense probably null
R0448:Sptan1 UTSW 2 29,916,822 (GRCm39) missense probably damaging 1.00
R0485:Sptan1 UTSW 2 29,903,860 (GRCm39) splice site probably benign
R0580:Sptan1 UTSW 2 29,897,587 (GRCm39) missense probably damaging 0.99
R0739:Sptan1 UTSW 2 29,903,530 (GRCm39) missense probably damaging 1.00
R0924:Sptan1 UTSW 2 29,906,040 (GRCm39) missense probably damaging 0.98
R0930:Sptan1 UTSW 2 29,906,040 (GRCm39) missense probably damaging 0.98
R0961:Sptan1 UTSW 2 29,870,075 (GRCm39) splice site probably null
R1352:Sptan1 UTSW 2 29,911,199 (GRCm39) splice site probably benign
R1456:Sptan1 UTSW 2 29,870,215 (GRCm39) critical splice donor site probably null
R1537:Sptan1 UTSW 2 29,916,034 (GRCm39) missense possibly damaging 0.95
R1542:Sptan1 UTSW 2 29,917,139 (GRCm39) missense probably damaging 1.00
R1612:Sptan1 UTSW 2 29,893,348 (GRCm39) missense probably damaging 1.00
R1623:Sptan1 UTSW 2 29,876,432 (GRCm39) missense probably damaging 0.96
R1834:Sptan1 UTSW 2 29,882,013 (GRCm39) splice site probably benign
R1879:Sptan1 UTSW 2 29,885,540 (GRCm39) missense probably damaging 1.00
R1893:Sptan1 UTSW 2 29,910,472 (GRCm39) missense probably damaging 0.98
R1914:Sptan1 UTSW 2 29,901,048 (GRCm39) missense probably benign 0.00
R1915:Sptan1 UTSW 2 29,901,048 (GRCm39) missense probably benign 0.00
R2022:Sptan1 UTSW 2 29,897,573 (GRCm39) missense probably damaging 0.96
R2050:Sptan1 UTSW 2 29,892,250 (GRCm39) missense probably benign
R2103:Sptan1 UTSW 2 29,920,483 (GRCm39) missense probably damaging 1.00
R2931:Sptan1 UTSW 2 29,908,500 (GRCm39) missense probably benign
R3726:Sptan1 UTSW 2 29,908,431 (GRCm39) missense possibly damaging 0.59
R4170:Sptan1 UTSW 2 29,920,037 (GRCm39) missense possibly damaging 0.93
R4235:Sptan1 UTSW 2 29,916,600 (GRCm39) missense probably damaging 1.00
R4378:Sptan1 UTSW 2 29,915,581 (GRCm39) missense probably damaging 1.00
R4424:Sptan1 UTSW 2 29,919,721 (GRCm39) intron probably benign
R4718:Sptan1 UTSW 2 29,921,074 (GRCm39) missense probably damaging 1.00
R4777:Sptan1 UTSW 2 29,886,447 (GRCm39) missense probably damaging 0.98
R4849:Sptan1 UTSW 2 29,901,054 (GRCm39) missense probably damaging 1.00
R5158:Sptan1 UTSW 2 29,868,455 (GRCm39) missense probably damaging 1.00
R5180:Sptan1 UTSW 2 29,883,736 (GRCm39) intron probably benign
R5181:Sptan1 UTSW 2 29,883,736 (GRCm39) intron probably benign
R5383:Sptan1 UTSW 2 29,901,340 (GRCm39) missense probably damaging 1.00
R5573:Sptan1 UTSW 2 29,876,504 (GRCm39) nonsense probably null
R5592:Sptan1 UTSW 2 29,876,731 (GRCm39) intron probably benign
R5639:Sptan1 UTSW 2 29,881,005 (GRCm39) nonsense probably null
R5801:Sptan1 UTSW 2 29,920,613 (GRCm39) splice site probably null
R5947:Sptan1 UTSW 2 29,884,379 (GRCm39) critical splice donor site probably null
R6056:Sptan1 UTSW 2 29,886,794 (GRCm39) missense probably benign 0.36
R6090:Sptan1 UTSW 2 29,883,899 (GRCm39) missense probably damaging 1.00
R6146:Sptan1 UTSW 2 29,894,535 (GRCm39) missense probably benign 0.01
R6254:Sptan1 UTSW 2 29,897,561 (GRCm39) missense possibly damaging 0.93
R6366:Sptan1 UTSW 2 29,910,467 (GRCm39) missense possibly damaging 0.47
R6378:Sptan1 UTSW 2 29,908,527 (GRCm39) missense probably damaging 1.00
R6521:Sptan1 UTSW 2 29,910,467 (GRCm39) missense possibly damaging 0.47
R6877:Sptan1 UTSW 2 29,920,985 (GRCm39) missense probably damaging 0.99
R7173:Sptan1 UTSW 2 29,873,221 (GRCm39) missense probably benign 0.02
R7248:Sptan1 UTSW 2 29,892,311 (GRCm39) missense probably benign 0.10
R7282:Sptan1 UTSW 2 29,876,941 (GRCm39) missense probably damaging 1.00
R7527:Sptan1 UTSW 2 29,870,209 (GRCm39) missense probably damaging 1.00
R7585:Sptan1 UTSW 2 29,890,068 (GRCm39) missense probably benign 0.06
R7779:Sptan1 UTSW 2 29,911,319 (GRCm39) missense probably damaging 1.00
R8051:Sptan1 UTSW 2 29,920,171 (GRCm39) missense probably damaging 1.00
R8055:Sptan1 UTSW 2 29,884,351 (GRCm39) missense probably benign 0.22
R8103:Sptan1 UTSW 2 29,910,055 (GRCm39) missense probably damaging 1.00
R8283:Sptan1 UTSW 2 29,870,212 (GRCm39) missense probably damaging 1.00
R8507:Sptan1 UTSW 2 29,916,596 (GRCm39) missense probably damaging 1.00
R8963:Sptan1 UTSW 2 29,873,744 (GRCm39) missense possibly damaging 0.92
R9126:Sptan1 UTSW 2 29,920,597 (GRCm39) missense probably damaging 0.99
R9206:Sptan1 UTSW 2 29,920,724 (GRCm39) missense possibly damaging 0.90
R9273:Sptan1 UTSW 2 29,880,977 (GRCm39) missense possibly damaging 0.88
X0028:Sptan1 UTSW 2 29,910,042 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGTGCCTTCGACACCT -3'
(R):5'- AAAAGAAATGGCTTGTTTATATGCC -3'

Sequencing Primer
(F):5'- TTCGACACCTCCCAAGTGAAAGAG -3'
(R):5'- GAGAGGCTAGTTTACATAGTGATCCC -3'
Posted On 2014-10-01