Incidental Mutation 'R2247:Shisa3'
ID240893
Institutional Source Beutler Lab
Gene Symbol Shisa3
Ensembl Gene ENSMUSG00000050010
Gene Nameshisa family member 3
SynonymsmShisa3, D830007B15Rik
MMRRC Submission 040247-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2247 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location67607882-67623552 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 67611323 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 189 (V189M)
Ref Sequence ENSEMBL: ENSMUSP00000084494 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087241] [ENSMUST00000142843]
Predicted Effect probably benign
Transcript: ENSMUST00000087241
AA Change: V189M

PolyPhen 2 Score 0.349 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000084494
Gene: ENSMUSG00000050010
AA Change: V189M

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Shisa 25 202 6.7e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142843
SMART Domains Protein: ENSMUSP00000138599
Gene: ENSMUSG00000050010

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Shisa 23 100 2.6e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200753
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted null mutation are viable, fertile and apparently normal with no defects in head development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A G 17: 56,877,435 E70G possibly damaging Het
5830411N06Rik G A 7: 140,249,129 G234S probably null Het
Ash1l C A 3: 89,007,367 P1768Q possibly damaging Het
Bicra C A 7: 15,989,234 E119D probably benign Het
Brd2 A G 17: 34,114,415 F421L probably damaging Het
Cspp1 A T 1: 10,066,460 Q182L possibly damaging Het
Dnah7b A G 1: 46,277,063 D3112G probably damaging Het
Dsc2 T A 18: 20,035,312 I697F probably damaging Het
Ephb1 A T 9: 101,996,811 S555T probably damaging Het
Fat4 A T 3: 38,892,049 D1697V probably damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Impg2 A G 16: 56,268,264 K1160R probably damaging Het
Jak2 T C 19: 29,283,636 V344A probably benign Het
Kcnab3 A G 11: 69,330,190 T168A probably damaging Het
Kctd18 A T 1: 57,967,642 H16Q possibly damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Mum1 A G 10: 80,240,425 Y483C probably damaging Het
Myh11 A G 16: 14,277,559 L113P probably damaging Het
Myh13 A T 11: 67,334,558 I250F probably damaging Het
Nin T C 12: 70,054,545 Y426C probably damaging Het
Olfr479 C T 7: 108,055,782 R267C probably benign Het
Olfr613 T A 7: 103,551,890 probably null Het
Pbrm1 A G 14: 31,074,893 H897R probably damaging Het
Plcl2 T C 17: 50,606,845 V294A probably damaging Het
Psapl1 A G 5: 36,205,066 E334G probably benign Het
Raly A G 2: 154,864,033 H277R possibly damaging Het
Ranbp9 T C 13: 43,412,425 K462E probably damaging Het
Rptn A G 3: 93,396,829 T490A probably benign Het
Rtl1 T C 12: 109,594,979 H142R possibly damaging Het
Slc25a36 A T 9: 97,100,138 L28Q probably damaging Het
Slc38a8 A G 8: 119,485,650 M318T probably benign Het
Slc4a11 A T 2: 130,687,801 M328K probably benign Het
Sp2 A C 11: 96,962,018 probably null Het
Sult2b1 A T 7: 45,735,310 I114N probably damaging Het
Synrg T C 11: 84,009,376 S803P probably damaging Het
Tenm4 T A 7: 96,906,009 D2603E probably benign Het
Tmem246 T C 4: 49,586,209 S320G probably benign Het
Tnfaip8 ACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC ACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC 18: 50,046,845 probably null Het
Zfp189 T A 4: 49,530,393 C499S possibly damaging Het
Zfp236 A G 18: 82,604,298 F1621S possibly damaging Het
Other mutations in Shisa3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01770:Shisa3 APN 5 67611065 missense probably damaging 1.00
IGL02998:Shisa3 APN 5 67608505 missense possibly damaging 0.47
R1416:Shisa3 UTSW 5 67611434 missense probably benign
R1654:Shisa3 UTSW 5 67611059 missense probably damaging 1.00
R2048:Shisa3 UTSW 5 67611308 missense possibly damaging 0.68
R4651:Shisa3 UTSW 5 67608649 missense probably damaging 0.99
R6243:Shisa3 UTSW 5 67611143 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TAGTGGCTATCTATTGTTGCACC -3'
(R):5'- TGTGGCCTATTCACAGCCATC -3'

Sequencing Primer
(F):5'- GTTGCACCTGTTTGAGACCCAAG -3'
(R):5'- TCGCCCCGTCAACTGGAAC -3'
Posted On2014-10-15