Incidental Mutation 'R2220:Bicc1'
ID241438
Institutional Source Beutler Lab
Gene Symbol Bicc1
Ensembl Gene ENSMUSG00000014329
Gene NameBicC family RNA binding protein 1
SynonymsBic-C, jcpk
MMRRC Submission 040222-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2220 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location70922832-71159700 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 70950125 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 396 (S396P)
Ref Sequence ENSEMBL: ENSMUSP00000123201 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014473] [ENSMUST00000131445] [ENSMUST00000143791]
Predicted Effect probably damaging
Transcript: ENSMUST00000014473
AA Change: S396P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000014473
Gene: ENSMUSG00000014329
AA Change: S396P

DomainStartEndE-ValueType
KH 47 129 2.69e0 SMART
KH 133 206 6.24e-18 SMART
KH 285 355 1.25e-8 SMART
low complexity region 384 402 N/A INTRINSIC
low complexity region 447 467 N/A INTRINSIC
low complexity region 480 499 N/A INTRINSIC
low complexity region 700 718 N/A INTRINSIC
low complexity region 736 747 N/A INTRINSIC
low complexity region 794 815 N/A INTRINSIC
SAM 872 938 2.04e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000131445
AA Change: S314P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000119137
Gene: ENSMUSG00000014329
AA Change: S314P

DomainStartEndE-ValueType
SCOP:d1dtja_ 1 46 1e-2 SMART
Blast:KH 1 47 1e-22 BLAST
KH 51 124 6.24e-18 SMART
KH 203 273 1.25e-8 SMART
low complexity region 302 320 N/A INTRINSIC
low complexity region 365 385 N/A INTRINSIC
low complexity region 398 417 N/A INTRINSIC
low complexity region 618 636 N/A INTRINSIC
low complexity region 654 665 N/A INTRINSIC
low complexity region 712 733 N/A INTRINSIC
SAM 790 856 2.04e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000143791
AA Change: S396P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000123201
Gene: ENSMUSG00000014329
AA Change: S396P

DomainStartEndE-ValueType
KH 47 129 2.69e0 SMART
KH 133 206 6.24e-18 SMART
KH 285 355 1.25e-8 SMART
low complexity region 384 402 N/A INTRINSIC
low complexity region 447 467 N/A INTRINSIC
low complexity region 480 499 N/A INTRINSIC
low complexity region 700 718 N/A INTRINSIC
low complexity region 736 747 N/A INTRINSIC
low complexity region 794 815 N/A INTRINSIC
SAM 872 938 4.26e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144740
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an RNA-binding protein that is active in regulating gene expression by modulating protein translation during embryonic development. Mouse studies identified the corresponding protein to be under strict control during cell differentiation and to be a maternally provided gene product. [provided by RefSeq, Apr 2009]
PHENOTYPE: Homozygous inactivation of this gene causes heteroxia, impaired nodal flow, ventricular septal defects, partial prenatal lethality and postnatal death due to renal failure. Chemically induced mutants develop kidney cysts and may show bulging abdomens, bile duct anomalies and cardiovascular defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 36,875,530 probably null Het
Aadacl4 T C 4: 144,618,002 I116T probably damaging Het
Aatk G T 11: 120,012,177 F407L probably damaging Het
Abca8a A T 11: 110,026,855 L1586Q probably damaging Het
Aox2 A G 1: 58,349,130 probably null Het
Ap5m1 A G 14: 49,081,095 D420G probably damaging Het
Bcl6 A T 16: 23,972,632 L324* probably null Het
Ccdc83 G A 7: 90,259,514 S4L probably damaging Het
Cdkal1 T A 13: 29,354,758 M473L probably benign Het
Cep85 T C 4: 134,153,867 H363R probably damaging Het
Cfap61 G A 2: 146,036,816 probably null Het
Cfap65 T C 1: 74,904,025 I1614V probably damaging Het
Cluh T A 11: 74,667,121 F1062I probably damaging Het
Cntnap5a A T 1: 116,580,639 T1294S possibly damaging Het
Cops8 A C 1: 90,606,619 N94T probably benign Het
Csmd1 T C 8: 15,992,641 D2364G possibly damaging Het
Cyb5d1 T C 11: 69,395,045 D55G probably benign Het
Cyp2c29 A T 19: 39,287,232 I39F probably benign Het
Cyp2j8 T C 4: 96,444,625 S495G probably benign Het
Dhx30 A G 9: 110,087,635 L575P probably damaging Het
Dnah7a C T 1: 53,521,174 V2113I probably benign Het
Dusp3 T C 11: 101,974,805 N95D probably damaging Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fam208b A T 13: 3,581,872 N876K probably benign Het
Fer1l4 T G 2: 156,031,764 Y1207S probably damaging Het
Flg2 T G 3: 93,202,185 S507A unknown Het
Gdf6 A G 4: 9,844,770 H98R probably damaging Het
Ggnbp2 T C 11: 84,836,613 N63S possibly damaging Het
Ggt7 A G 2: 155,495,719 S504P probably damaging Het
Gm14548 A T 7: 3,897,489 N87K probably benign Het
Gtf2h5 G A 17: 6,084,578 E48K probably benign Het
Hivep3 T G 4: 119,734,038 V81G possibly damaging Het
Igsf21 A G 4: 140,028,114 M410T probably damaging Het
Insrr T C 3: 87,809,418 L651P probably damaging Het
Iqcb1 A T 16: 36,843,462 probably null Het
Klhdc7a G A 4: 139,965,453 R728C probably benign Het
Lars2 T C 9: 123,418,780 L334P probably damaging Het
Mast3 T C 8: 70,780,963 E994G probably damaging Het
Mertk T A 2: 128,801,472 N930K probably benign Het
Mettl21a A T 1: 64,616,283 V46E probably damaging Het
Nedd4 T A 9: 72,736,707 C614S probably damaging Het
Olfr168 A T 16: 19,530,145 Y258* probably null Het
Olfr173 G T 16: 58,797,624 A74D possibly damaging Het
Olfr525 T C 7: 140,323,571 S291P probably benign Het
Pard3b C T 1: 62,479,683 R976* probably null Het
Pcdhb16 A G 18: 37,478,967 T327A probably benign Het
Ppp1r37 C A 7: 19,532,446 R465L probably null Het
Ppp3ca C A 3: 136,797,924 T86K probably damaging Het
Ralgapa2 G A 2: 146,421,679 T706I probably benign Het
Rnf213 T C 11: 119,436,428 L1747P possibly damaging Het
Slc11a1 T A 1: 74,380,665 F166I probably damaging Het
Slc25a18 G A 6: 120,793,557 probably null Het
Stt3a A G 9: 36,749,551 probably null Het
Supt16 G A 14: 52,172,144 R770* probably null Het
Syde2 A G 3: 146,001,958 I551V probably benign Het
Tecta T C 9: 42,392,030 D102G probably damaging Het
Tmc7 A T 7: 118,552,816 I294N possibly damaging Het
Tmem174 T C 13: 98,637,259 Y21C probably damaging Het
Tomm40l A T 1: 171,221,981 L13* probably null Het
Trim30c A G 7: 104,383,267 V284A probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Uggt2 A T 14: 119,075,337 N353K probably damaging Het
Vps13d C T 4: 145,178,320 V79M probably damaging Het
Wfdc18 C T 11: 83,709,913 R45* probably null Het
Other mutations in Bicc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00961:Bicc1 APN 10 70961157 missense probably damaging 1.00
IGL01988:Bicc1 APN 10 70956176 missense probably damaging 1.00
IGL02686:Bicc1 APN 10 70943360 splice site probably benign
IGL02829:Bicc1 APN 10 70958880 missense probably damaging 1.00
IGL03276:Bicc1 APN 10 70953438 missense possibly damaging 0.76
IGL03354:Bicc1 APN 10 70946602 missense probably benign 0.00
artemis UTSW 10 71027954 missense probably damaging 0.99
Pebbles UTSW 10 70947900 missense possibly damaging 0.95
PIT1430001:Bicc1 UTSW 10 70957681 missense possibly damaging 0.94
R0095:Bicc1 UTSW 10 70961158 missense probably damaging 1.00
R0142:Bicc1 UTSW 10 70925370 missense probably damaging 1.00
R0184:Bicc1 UTSW 10 71079215 missense probably benign
R0469:Bicc1 UTSW 10 71079215 missense probably benign
R0485:Bicc1 UTSW 10 70925315 missense probably damaging 0.96
R0520:Bicc1 UTSW 10 70957190 missense probably damaging 0.96
R0884:Bicc1 UTSW 10 70958847 missense probably damaging 1.00
R1678:Bicc1 UTSW 10 70943518 missense probably damaging 1.00
R1892:Bicc1 UTSW 10 70958784 missense probably damaging 1.00
R1943:Bicc1 UTSW 10 71159523 missense probably damaging 1.00
R2240:Bicc1 UTSW 10 70946803 critical splice donor site probably null
R2519:Bicc1 UTSW 10 70930644 missense probably damaging 1.00
R4362:Bicc1 UTSW 10 70943374 frame shift probably null
R4363:Bicc1 UTSW 10 70943374 frame shift probably null
R4419:Bicc1 UTSW 10 70946974 missense possibly damaging 0.73
R4697:Bicc1 UTSW 10 70953484 missense possibly damaging 0.87
R4728:Bicc1 UTSW 10 70935831 critical splice donor site probably null
R4765:Bicc1 UTSW 10 70940593 missense probably damaging 1.00
R4838:Bicc1 UTSW 10 70945316 missense possibly damaging 0.50
R5022:Bicc1 UTSW 10 70947883 missense possibly damaging 0.79
R5023:Bicc1 UTSW 10 70947883 missense possibly damaging 0.79
R5057:Bicc1 UTSW 10 70947883 missense possibly damaging 0.79
R5082:Bicc1 UTSW 10 70940522 missense probably benign 0.05
R5160:Bicc1 UTSW 10 70932236 missense probably damaging 1.00
R5294:Bicc1 UTSW 10 70947900 missense possibly damaging 0.95
R5639:Bicc1 UTSW 10 70940520 missense probably damaging 1.00
R5749:Bicc1 UTSW 10 70946969 missense probably benign 0.00
R6045:Bicc1 UTSW 10 70957081 nonsense probably null
R6128:Bicc1 UTSW 10 70940483 splice site probably null
R6277:Bicc1 UTSW 10 71027901 missense possibly damaging 0.74
R6389:Bicc1 UTSW 10 70958922 missense probably damaging 1.00
R7021:Bicc1 UTSW 10 70961148 missense probably damaging 0.99
R7101:Bicc1 UTSW 10 70930653 missense probably damaging 1.00
R7351:Bicc1 UTSW 10 70947900 missense probably benign 0.18
R7352:Bicc1 UTSW 10 70947900 missense probably benign 0.18
R7353:Bicc1 UTSW 10 70947900 missense probably benign 0.18
R7366:Bicc1 UTSW 10 70943386 missense probably benign 0.01
R7480:Bicc1 UTSW 10 70943476 missense probably damaging 1.00
R7541:Bicc1 UTSW 10 70946604 missense possibly damaging 0.82
R7544:Bicc1 UTSW 10 70956374 missense possibly damaging 0.89
R7555:Bicc1 UTSW 10 70956291 missense possibly damaging 0.75
X0028:Bicc1 UTSW 10 70945336 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACCTAGTCCAGTGAGTCCGAG -3'
(R):5'- TCTCAATGGTTTGCAGACACATAG -3'

Sequencing Primer
(F):5'- GGCCTGCCGAAGCTAAGATATC -3'
(R):5'- TGGTTTGCAGACACATAGACACAC -3'
Posted On2014-10-15