Incidental Mutation 'R0166:Ddx28'
ID24177
Institutional Source Beutler Lab
Gene Symbol Ddx28
Ensembl Gene ENSMUSG00000045538
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 28
Synonyms2410004K13Rik, Mddx28
MMRRC Submission 038442-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.894) question?
Stock #R0166 (G1)
Quality Score225
Status Validated (trace)
Chromosome8
Chromosomal Location106009621-106011882 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 106010289 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 379 (T379I)
Ref Sequence ENSEMBL: ENSMUSP00000058950 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034375] [ENSMUST00000058579] [ENSMUST00000119736] [ENSMUST00000142898] [ENSMUST00000227778]
Predicted Effect probably benign
Transcript: ENSMUST00000034375
SMART Domains Protein: ENSMUSP00000034375
Gene: ENSMUSG00000031901

DomainStartEndE-ValueType
Pfam:Dus 15 344 1.8e-54 PFAM
DSRM 370 435 1.03e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000058579
AA Change: T379I

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000058950
Gene: ENSMUSG00000045538
AA Change: T379I

DomainStartEndE-ValueType
low complexity region 8 18 N/A INTRINSIC
low complexity region 42 58 N/A INTRINSIC
DEXDc 147 365 1.64e-40 SMART
HELICc 411 492 6.89e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119736
SMART Domains Protein: ENSMUSP00000113781
Gene: ENSMUSG00000031901

DomainStartEndE-ValueType
Pfam:Dus 1 233 8.1e-38 PFAM
DSRM 257 322 1.03e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141374
Predicted Effect probably benign
Transcript: ENSMUST00000142898
Predicted Effect probably benign
Transcript: ENSMUST00000227778
Meta Mutation Damage Score 0.1616 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.9%
  • 20x: 91.4%
Validation Efficiency 91% (49/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure, such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of the DEAD box protein family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene is intronless. It encodes an RNA-dependent ATPase. The encoded protein is localized in the mitochondria and the nucleus, and can be transported between the mitochondria and the nucleus. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T C 5: 8,853,468 F1040L probably damaging Het
Adamts7 A G 9: 90,193,692 N1201S probably benign Het
Ahnak C T 19: 9,005,725 P1458S probably damaging Het
Akap6 T C 12: 53,140,924 V1707A probably benign Het
Akr1c21 T A 13: 4,581,264 V266E probably damaging Het
Arap2 A C 5: 62,676,018 C894G probably damaging Het
Atp2a2 T C 5: 122,466,838 D426G possibly damaging Het
Azi2 A T 9: 118,055,841 Q132L possibly damaging Het
Carmil1 C T 13: 24,099,049 D91N probably damaging Het
Cnot7 A T 8: 40,507,453 probably null Het
Cntnap5b A G 1: 100,274,361 E311G probably benign Het
Csmd1 A G 8: 16,233,022 V640A probably benign Het
Cst7 T C 2: 150,575,727 S31P probably benign Het
Cyp7b1 T A 3: 18,097,366 I228L probably benign Het
Dirc2 G A 16: 35,719,314 T379I possibly damaging Het
Drd1 T A 13: 54,053,581 I205F probably damaging Het
Flnb T A 14: 7,896,115 V837D probably damaging Het
Fsd1l A G 4: 53,647,664 probably null Het
Fubp1 T A 3: 152,220,204 Y264* probably null Het
Gbp5 T A 3: 142,506,919 probably null Het
Gm13088 T A 4: 143,654,511 H314L probably benign Het
Gm7094 A G 1: 21,272,734 noncoding transcript Het
Gpr55 A G 1: 85,941,136 V241A probably benign Het
Impa1 C T 3: 10,328,960 A16T probably damaging Het
Llgl2 T C 11: 115,844,854 L92P probably damaging Het
Ltbp2 T A 12: 84,786,358 Q1472L probably benign Het
Lyplal1 A T 1: 186,088,746 M168K probably benign Het
Macc1 A T 12: 119,447,080 R528* probably null Het
Mdm1 T A 10: 118,166,680 D635E probably damaging Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Mrpl23 C T 7: 142,535,114 R69W probably damaging Het
Ncoa6 TGC TGCGC 2: 155,408,291 probably null Het
Nr0b2 A G 4: 133,553,738 Q105R probably damaging Het
Olfr920 T A 9: 38,756,188 S167T probably benign Het
Otog G A 7: 46,304,231 V2638M probably damaging Het
Pcdhb14 A T 18: 37,448,489 probably null Het
Plxna1 A G 6: 89,333,019 W1055R probably damaging Het
Prdm1 C T 10: 44,440,091 R716Q probably damaging Het
Proser1 C A 3: 53,480,617 Q909K possibly damaging Het
Pus10 T A 11: 23,667,358 C24S probably damaging Het
Rpl27 T A 11: 101,445,320 F69I possibly damaging Het
Sctr A T 1: 120,055,394 I325F probably damaging Het
Slc5a3 G A 16: 92,077,693 V213I possibly damaging Het
Spib G T 7: 44,529,900 D28E probably damaging Het
Spic T C 10: 88,675,717 S226G possibly damaging Het
Tet1 T A 10: 62,840,279 T673S probably benign Het
Tph1 A G 7: 46,647,596 F392L probably damaging Het
Ttc28 T C 5: 111,225,634 S979P probably benign Het
Unc79 T C 12: 103,156,553 L2110P probably damaging Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Zfp467 T C 6: 48,438,681 T346A probably benign Het
Other mutations in Ddx28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01314:Ddx28 APN 8 106010580 missense probably damaging 0.97
R0329:Ddx28 UTSW 8 106010245 missense probably benign 0.00
R0362:Ddx28 UTSW 8 106011294 missense probably damaging 0.99
R0464:Ddx28 UTSW 8 106010053 missense probably damaging 1.00
R1267:Ddx28 UTSW 8 106009917 missense probably damaging 1.00
R1686:Ddx28 UTSW 8 106010558 missense probably damaging 1.00
R1748:Ddx28 UTSW 8 106010682 missense probably benign 0.01
R2201:Ddx28 UTSW 8 106010574 missense probably damaging 1.00
R4005:Ddx28 UTSW 8 106010928 missense possibly damaging 0.80
R6456:Ddx28 UTSW 8 106010368 missense possibly damaging 0.94
R6601:Ddx28 UTSW 8 106010616 unclassified probably null
Predicted Primers PCR Primer
(F):5'- TGGAAACTCTGGAAGATACCTGCCC -3'
(R):5'- AAAGTCCAGCCGAGTTAGAAGACCC -3'

Sequencing Primer
(F):5'- GGAAGATACCTGCCCTCATTG -3'
(R):5'- CGAGTTAGAAGACCCCTTTAATCC -3'
Posted On2013-04-16