Incidental Mutation 'R0167:Galnt14'
ID24245
Institutional Source Beutler Lab
Gene Symbol Galnt14
Ensembl Gene ENSMUSG00000024064
Gene Namepolypeptide N-acetylgalactosaminyltransferase 14
Synonyms0610033M06Rik
MMRRC Submission 038443-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.235) question?
Stock #R0167 (G1)
Quality Score225
Status Validated (trace)
Chromosome17
Chromosomal Location73493228-73710453 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 73522720 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 277 (T277A)
Ref Sequence ENSEMBL: ENSMUSP00000024858 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024858] [ENSMUST00000112591]
Predicted Effect probably damaging
Transcript: ENSMUST00000024858
AA Change: T277A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000024858
Gene: ENSMUSG00000024064
AA Change: T277A

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 111 359 1.4e-10 PFAM
Pfam:Glycos_transf_2 114 294 7.5e-30 PFAM
Pfam:Glyco_tranf_2_2 114 333 1.5e-8 PFAM
Pfam:Glyco_transf_7C 271 340 7e-8 PFAM
RICIN 420 548 7.23e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112591
AA Change: T277A

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000108210
Gene: ENSMUSG00000024064
AA Change: T277A

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 111 359 1.1e-10 PFAM
Pfam:Glycos_transf_2 114 291 2.4e-27 PFAM
Pfam:Glyco_tranf_2_2 114 333 1.7e-8 PFAM
Pfam:Glyco_transf_7C 270 340 9e-8 PFAM
low complexity region 415 429 N/A INTRINSIC
Meta Mutation Damage Score 0.174 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency 95% (58/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a Golgi protein which is a member of the polypeptide N-acetylgalactosaminyltransferase (ppGalNAc-Ts) protein family. These enzymes catalyze the transfer of N-acetyl-D-galactosamine (GalNAc) to the hydroxyl groups on serines and threonines in target peptides. The encoded protein has been shown to transfer GalNAc to large proteins like mucins. Alterations in this gene may play a role in cancer progression and response to chemotherapy. [provided by RefSeq, Jun 2016]
PHENOTYPE: Homozygous mutant mice exhibit enhanced motor coordination during inverted screen testing when compared with controls. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl11 T C 9: 107,929,770 F431L probably damaging Het
Ahrr G A 13: 74,283,024 probably benign Het
Bsn T C 9: 108,125,986 T407A probably benign Het
Ccdc96 T C 5: 36,485,153 F168L probably benign Het
Cckar A T 5: 53,706,453 S55R probably damaging Het
Cdh5 A C 8: 104,136,735 I426L possibly damaging Het
Clcn1 T C 6: 42,286,836 Y24H probably damaging Het
Clpx G A 9: 65,316,737 R271K possibly damaging Het
Col6a3 C T 1: 90,798,173 G1978D probably damaging Het
Cpne2 T C 8: 94,568,579 probably benign Het
D630023F18Rik A G 1: 65,117,181 V51A possibly damaging Het
Dcaf4 G A 12: 83,535,988 probably benign Het
Dlk2 C A 17: 46,302,604 R262S possibly damaging Het
Dubr G T 16: 50,732,644 noncoding transcript Het
Elane T A 10: 79,887,099 probably null Het
Eya2 T G 2: 165,716,112 S209R possibly damaging Het
Fam171a1 C T 2: 3,186,432 S112L probably damaging Het
Fsip2 T A 2: 82,980,807 M2490K possibly damaging Het
Gm5771 T A 6: 41,396,261 probably benign Het
Golga1 T C 2: 39,047,648 N128S probably benign Het
Hdac2 T C 10: 37,000,372 V461A probably benign Het
Hey2 A G 10: 30,840,665 V34A probably benign Het
Hist1h1t T C 13: 23,695,903 V13A probably benign Het
Ift22 T C 5: 136,911,891 C137R probably benign Het
Lrp2 T C 2: 69,425,658 D4657G possibly damaging Het
Lrrn3 T A 12: 41,454,015 Q101L probably damaging Het
Med25 A G 7: 44,883,097 probably null Het
Mup5 T A 4: 61,833,782 probably null Het
Olfr1497 T C 19: 13,795,567 T15A probably benign Het
Olfr205 A T 16: 59,328,974 C178* probably null Het
Olfr611 A T 7: 103,517,501 Y294* probably null Het
Otog G A 7: 46,304,231 V2638M probably damaging Het
Parg T C 14: 32,217,736 probably null Het
Prep A G 10: 45,158,230 probably null Het
Psip1 T C 4: 83,466,818 probably null Het
Rbbp8 T A 18: 11,660,922 Y30* probably null Het
Rhbdd1 T C 1: 82,342,784 V163A probably benign Het
Setd2 T A 9: 110,573,782 N1830K probably damaging Het
Shc4 T G 2: 125,723,013 N122T probably benign Het
Shroom3 T C 5: 92,948,395 probably benign Het
Snx14 A T 9: 88,407,416 L261Q probably damaging Het
St8sia1 A G 6: 142,914,181 probably benign Het
Thbs2 A T 17: 14,667,525 probably benign Het
Tpp2 T C 1: 43,970,488 V494A probably benign Het
Trdmt1 A T 2: 13,516,018 F358I probably damaging Het
Ttn T A 2: 76,889,523 probably benign Het
Uggt1 A G 1: 36,170,197 probably null Het
Uhrf1bp1 C T 17: 27,880,202 T246M possibly damaging Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Vstm2a T A 11: 16,258,044 F13I probably damaging Het
Zfp804a T G 2: 82,256,516 F230V probably damaging Het
Other mutations in Galnt14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Galnt14 APN 17 73494232 missense probably damaging 1.00
IGL01295:Galnt14 APN 17 73504919 missense probably benign 0.01
IGL01578:Galnt14 APN 17 73535366 splice site probably benign
IGL01833:Galnt14 APN 17 73504904 missense probably benign
IGL02572:Galnt14 APN 17 73535267 missense probably damaging 1.00
IGL02890:Galnt14 APN 17 73509524 critical splice donor site probably null
IGL03145:Galnt14 APN 17 73504908 missense possibly damaging 0.63
IGL03175:Galnt14 APN 17 73522654 missense probably damaging 1.00
R0051:Galnt14 UTSW 17 73507859 missense probably benign 0.00
R0112:Galnt14 UTSW 17 73574984 splice site probably benign
R0525:Galnt14 UTSW 17 73545081 missense probably damaging 1.00
R0675:Galnt14 UTSW 17 73545035 missense probably damaging 1.00
R1192:Galnt14 UTSW 17 73545138 splice site probably benign
R1335:Galnt14 UTSW 17 73526290 missense probably damaging 1.00
R1549:Galnt14 UTSW 17 73525313 missense possibly damaging 0.79
R1824:Galnt14 UTSW 17 73709939 missense probably benign 0.01
R2061:Galnt14 UTSW 17 73512153 missense probably damaging 1.00
R2259:Galnt14 UTSW 17 73494266 missense probably benign 0.00
R3844:Galnt14 UTSW 17 73709929 critical splice donor site probably null
R4257:Galnt14 UTSW 17 73504904 missense probably benign
R4364:Galnt14 UTSW 17 73512159 missense probably damaging 0.99
R4664:Galnt14 UTSW 17 73507813 intron probably benign
R4744:Galnt14 UTSW 17 73507833 missense probably damaging 1.00
R4810:Galnt14 UTSW 17 73512121 missense probably damaging 0.99
R4840:Galnt14 UTSW 17 73504898 missense probably benign 0.01
R4846:Galnt14 UTSW 17 73536893 missense probably benign 0.19
R5328:Galnt14 UTSW 17 73505459 missense possibly damaging 0.46
R5507:Galnt14 UTSW 17 73495666 missense probably damaging 0.98
R5816:Galnt14 UTSW 17 73574882 missense probably damaging 1.00
R5872:Galnt14 UTSW 17 73574831 missense probably damaging 1.00
R5933:Galnt14 UTSW 17 73526305 missense probably benign 0.01
R6490:Galnt14 UTSW 17 73525370 missense probably damaging 0.98
R7117:Galnt14 UTSW 17 73494195 missense probably benign 0.00
R7128:Galnt14 UTSW 17 73545101 missense probably benign
X0067:Galnt14 UTSW 17 73509526 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GTGACTCAGATTTCCCAGAAACCCC -3'
(R):5'- CTGCAAGGTCAAGGAATTGTCAAGC -3'

Sequencing Primer
(F):5'- CCTGCCAGGTTAAGGACACAG -3'
(R):5'- TTGTCAAGCAGAGGACAGACC -3'
Posted On2013-04-16