Incidental Mutation 'R0172:Atp12a'
ID24292
Institutional Source Beutler Lab
Gene Symbol Atp12a
Ensembl Gene ENSMUSG00000022229
Gene NameATPase, H+/K+ transporting, nongastric, alpha polypeptide
SynonymscHKA, ATPase H+K+-transporting, alpha 2, Atp1al1, HKalpha2
MMRRC Submission 038444-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0172 (G1)
Quality Score225
Status Validated (trace)
Chromosome14
Chromosomal Location56365068-56388550 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 56372844 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 224 (V224A)
Ref Sequence ENSEMBL: ENSMUSP00000007340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007340]
Predicted Effect probably damaging
Transcript: ENSMUST00000007340
AA Change: V224A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000007340
Gene: ENSMUSG00000022229
AA Change: V224A

DomainStartEndE-ValueType
low complexity region 22 36 N/A INTRINSIC
Cation_ATPase_N 54 128 9.27e-15 SMART
Pfam:E1-E2_ATPase 145 376 9.8e-57 PFAM
Pfam:Hydrolase 381 740 7.8e-20 PFAM
Pfam:HAD 384 737 7.6e-19 PFAM
Pfam:Cation_ATPase 437 532 3.4e-26 PFAM
Pfam:Cation_ATPase_C 810 1020 9.9e-44 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225567
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225698
Meta Mutation Damage Score 0.266 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.4%
Validation Efficiency 82% (40/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases. This gene encodes a catalytic subunit of the ouabain-sensitive H+/K+ -ATPase that catalyzes the hydrolysis of ATP coupled with the exchange of H(+) and K(+) ions across the plasma membrane. It is also responsible for potassium absorption in various tissues. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2010]
PHENOTYPE: Homozygous mutation of this gene results in increased potassium excretion. When placed on a potassium-free diet, mutant animals display greater weight loss and slightly increased kidney weight compared to wild-type. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430033K04Rik T A 5: 138,647,316 C488S probably damaging Het
Abca12 T G 1: 71,279,402 D1814A probably damaging Het
Acp7 T C 7: 28,615,124 N272S possibly damaging Het
Ank3 T C 10: 69,976,058 V1145A probably damaging Het
Ap1m2 A T 9: 21,298,332 probably null Het
Cdh23 T C 10: 60,319,632 E2253G probably damaging Het
Cep350 T C 1: 155,953,447 N237S probably benign Het
Crispld2 T C 8: 120,026,071 V286A possibly damaging Het
Cyp2c65 G T 19: 39,087,656 V351L possibly damaging Het
D130043K22Rik T C 13: 24,872,406 F574L probably benign Het
Dag1 G A 9: 108,208,832 T370M possibly damaging Het
Dmwd C T 7: 19,080,342 R306C probably damaging Het
Dnah11 T C 12: 117,987,453 Y3040C probably damaging Het
Dst C A 1: 34,270,854 H1536Q probably damaging Het
Eif3j1 A G 2: 122,051,765 I202V probably benign Het
Epg5 T A 18: 78,027,359 V2283D probably benign Het
Evi5 T C 5: 107,790,462 N625S probably benign Het
Exosc10 T C 4: 148,565,357 S415P probably benign Het
F830016B08Rik G T 18: 60,299,964 D40Y possibly damaging Het
Fam118a A G 15: 85,045,750 I60V probably benign Het
Fam186a A T 15: 99,954,887 M150K unknown Het
Fam193a C T 5: 34,465,613 R1182W probably damaging Het
Fastkd2 T A 1: 63,732,028 I181K possibly damaging Het
Hip1r T A 5: 123,996,940 Y380N possibly damaging Het
Hivep2 C A 10: 14,139,474 P1795Q probably damaging Het
Hnrnpab T C 11: 51,602,667 E238G probably damaging Het
Kcnma1 C T 14: 23,803,166 A172T probably damaging Het
Lipg G T 18: 74,948,174 H279N possibly damaging Het
Lrrc9 A G 12: 72,463,486 D453G possibly damaging Het
Map1s T A 8: 70,914,968 M839K probably benign Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Myo1h T A 5: 114,329,164 probably null Het
Ncoa6 TGC TGCGC 2: 155,408,291 probably null Het
Nrn1 T C 13: 36,730,570 R19G probably benign Het
Nwd2 T C 5: 63,806,369 Y1099H probably benign Het
Nxpe2 G A 9: 48,319,909 R387C possibly damaging Het
Olfr447 T C 6: 42,911,979 V152A probably benign Het
Pappa2 C T 1: 158,854,849 probably null Het
Pcdhb13 A T 18: 37,442,937 I123L probably benign Het
Plcg2 A G 8: 117,579,782 T292A probably benign Het
Pnpla8 T A 12: 44,311,328 V469D probably damaging Het
Pop4 T C 7: 38,263,255 Y195C probably damaging Het
Rbsn A T 6: 92,211,607 D42E probably damaging Het
Sclt1 A T 3: 41,717,787 I123N possibly damaging Het
Slc22a27 C A 19: 7,865,836 G393* probably null Het
Smu1 C T 4: 40,738,439 V432I probably benign Het
Sohlh1 A G 2: 25,846,203 probably null Het
Spta1 T A 1: 174,230,786 I1940K probably damaging Het
Sufu G T 19: 46,397,124 V8F possibly damaging Het
Tmem144 G A 3: 79,839,273 probably benign Het
Tmem184b A G 15: 79,378,540 V39A possibly damaging Het
Tmem236 A G 2: 14,218,883 D161G probably benign Het
Ufl1 T C 4: 25,280,685 K54R probably benign Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Other mutations in Atp12a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01382:Atp12a APN 14 56379955 missense probably damaging 1.00
IGL02108:Atp12a APN 14 56384068 missense possibly damaging 0.95
IGL02176:Atp12a APN 14 56387179 missense probably damaging 1.00
IGL02210:Atp12a APN 14 56371744 nonsense probably null
IGL02828:Atp12a APN 14 56376142 missense possibly damaging 0.72
IGL02868:Atp12a APN 14 56384182 missense probably damaging 1.00
IGL02876:Atp12a APN 14 56373289 missense probably benign 0.00
R0045:Atp12a UTSW 14 56372873 missense probably damaging 1.00
R0276:Atp12a UTSW 14 56387694 missense probably damaging 1.00
R0613:Atp12a UTSW 14 56374521 missense probably damaging 1.00
R0656:Atp12a UTSW 14 56374481 missense probably damaging 1.00
R0962:Atp12a UTSW 14 56368413 missense probably damaging 1.00
R1067:Atp12a UTSW 14 56373436 missense probably damaging 1.00
R1448:Atp12a UTSW 14 56385839 missense probably damaging 1.00
R1503:Atp12a UTSW 14 56373424 missense probably damaging 1.00
R1590:Atp12a UTSW 14 56380055 missense probably damaging 1.00
R1639:Atp12a UTSW 14 56384068 missense possibly damaging 0.95
R1660:Atp12a UTSW 14 56370848 missense probably benign 0.21
R1696:Atp12a UTSW 14 56366088 missense probably damaging 1.00
R1775:Atp12a UTSW 14 56372589 missense probably benign 0.23
R1920:Atp12a UTSW 14 56386851 missense probably benign 0.19
R2022:Atp12a UTSW 14 56365282 start codon destroyed probably null
R2071:Atp12a UTSW 14 56366009 missense probably benign
R2253:Atp12a UTSW 14 56376258 missense probably benign 0.03
R2289:Atp12a UTSW 14 56373262 missense possibly damaging 0.93
R2567:Atp12a UTSW 14 56386927 missense probably damaging 1.00
R2870:Atp12a UTSW 14 56386950 missense possibly damaging 0.94
R2870:Atp12a UTSW 14 56386950 missense possibly damaging 0.94
R2872:Atp12a UTSW 14 56386950 missense possibly damaging 0.94
R2872:Atp12a UTSW 14 56386950 missense possibly damaging 0.94
R2873:Atp12a UTSW 14 56386950 missense possibly damaging 0.94
R2923:Atp12a UTSW 14 56374622 missense probably benign
R3736:Atp12a UTSW 14 56374427 missense possibly damaging 0.90
R3754:Atp12a UTSW 14 56372588 missense probably benign 0.01
R5028:Atp12a UTSW 14 56386978 missense probably damaging 0.96
R5267:Atp12a UTSW 14 56384211 missense probably damaging 1.00
R5481:Atp12a UTSW 14 56373389 missense possibly damaging 0.90
R5590:Atp12a UTSW 14 56373380 missense probably benign 0.11
R5842:Atp12a UTSW 14 56378290 missense probably damaging 0.96
R5899:Atp12a UTSW 14 56373344 missense probably benign 0.44
R5985:Atp12a UTSW 14 56384341 missense probably damaging 1.00
R6044:Atp12a UTSW 14 56376155 missense probably damaging 1.00
R6271:Atp12a UTSW 14 56378422 missense probably benign 0.00
R6454:Atp12a UTSW 14 56370833 missense probably benign 0.02
R6461:Atp12a UTSW 14 56373238 missense probably damaging 1.00
R6610:Atp12a UTSW 14 56374556 missense probably damaging 1.00
R6666:Atp12a UTSW 14 56373364 missense probably benign 0.36
R6667:Atp12a UTSW 14 56384188 missense possibly damaging 0.82
R6677:Atp12a UTSW 14 56380854 missense probably damaging 1.00
R6791:Atp12a UTSW 14 56386982 critical splice donor site probably null
R7003:Atp12a UTSW 14 56373380 missense possibly damaging 0.87
R7173:Atp12a UTSW 14 56384380 missense probably damaging 1.00
X0004:Atp12a UTSW 14 56378467 missense probably benign 0.16
Z1088:Atp12a UTSW 14 56386141 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- TGTTTTCCCAAGGGTGCAAAGTGAG -3'
(R):5'- GTTGATGACAATGCCAGTTGCCG -3'

Sequencing Primer
(F):5'- AGTGAGTGTCAAGGACATCTTCC -3'
(R):5'- TTCCAAGGGGTTTTCATGGG -3'
Posted On2013-04-16