Incidental Mutation 'R1639:Atp12a'
ID173399
Institutional Source Beutler Lab
Gene Symbol Atp12a
Ensembl Gene ENSMUSG00000022229
Gene NameATPase, H+/K+ transporting, nongastric, alpha polypeptide
SynonymscHKA, ATPase H+K+-transporting, alpha 2, Atp1al1, HKalpha2
MMRRC Submission 039675-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1639 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location56365068-56388550 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 56384068 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 720 (D720V)
Ref Sequence ENSEMBL: ENSMUSP00000007340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007340]
Predicted Effect possibly damaging
Transcript: ENSMUST00000007340
AA Change: D720V

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000007340
Gene: ENSMUSG00000022229
AA Change: D720V

DomainStartEndE-ValueType
low complexity region 22 36 N/A INTRINSIC
Cation_ATPase_N 54 128 9.27e-15 SMART
Pfam:E1-E2_ATPase 145 376 9.8e-57 PFAM
Pfam:Hydrolase 381 740 7.8e-20 PFAM
Pfam:HAD 384 737 7.6e-19 PFAM
Pfam:Cation_ATPase 437 532 3.4e-26 PFAM
Pfam:Cation_ATPase_C 810 1020 9.9e-44 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225567
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225698
Meta Mutation Damage Score 0.184 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.7%
Validation Efficiency 96% (66/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases. This gene encodes a catalytic subunit of the ouabain-sensitive H+/K+ -ATPase that catalyzes the hydrolysis of ATP coupled with the exchange of H(+) and K(+) ions across the plasma membrane. It is also responsible for potassium absorption in various tissues. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2010]
PHENOTYPE: Homozygous mutation of this gene results in increased potassium excretion. When placed on a potassium-free diet, mutant animals display greater weight loss and slightly increased kidney weight compared to wild-type. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933417A18Rik T C 13: 34,944,250 I150T possibly damaging Het
Acss2 C A 2: 155,556,908 T425N probably benign Het
Adam18 T A 8: 24,652,152 I203L probably benign Het
Amigo2 A G 15: 97,245,998 M181T probably benign Het
Anks1 T A 17: 28,058,306 I1045N probably damaging Het
Ap3d1 C T 10: 80,730,010 V108I probably damaging Het
Arl8a C T 1: 135,152,823 R57* probably null Het
Brpf3 T C 17: 28,824,068 probably null Het
C2 T C 17: 34,872,403 K95E probably benign Het
Cdk19 T C 10: 40,476,969 probably null Het
Cebpz T A 17: 78,934,606 I540L possibly damaging Het
Cep128 A G 12: 91,366,368 V41A probably damaging Het
Cog7 T C 7: 121,981,419 E56G probably damaging Het
Cylc2 T C 4: 51,228,310 V127A probably benign Het
Cyp2b23 A G 7: 26,686,417 V5A possibly damaging Het
Cyp8b1 A G 9: 121,914,890 Y459H probably benign Het
Dbpht2 A G 12: 74,299,158 noncoding transcript Het
Ddx24 T C 12: 103,411,319 probably null Het
Dgki C T 6: 36,937,364 C757Y probably damaging Het
Eef2k T A 7: 120,885,828 L306H probably damaging Het
Ephb2 T C 4: 136,693,905 N378S probably benign Het
Espl1 C T 15: 102,320,714 T1767I probably damaging Het
Fbn2 C A 18: 58,058,462 A1530S probably benign Het
Fndc11 A G 2: 181,221,581 S60G possibly damaging Het
Glb1l G T 1: 75,199,601 Q612K probably benign Het
Gpsm1 A G 2: 26,345,187 E371G probably damaging Het
Gtpbp2 G A 17: 46,165,771 probably null Het
Itch A G 2: 155,179,025 probably null Het
Itga2 T C 13: 114,857,296 T774A probably benign Het
Kit A G 5: 75,652,807 I881V probably damaging Het
Lpar5 T C 6: 125,081,601 L95P probably damaging Het
Lrp6 T C 6: 134,453,566 T1511A possibly damaging Het
Mgat4c T C 10: 102,378,281 Y42H probably damaging Het
Mpp3 G T 11: 102,023,442 T109K probably damaging Het
Msantd4 A G 9: 4,385,199 E308G probably damaging Het
Mug1 T C 6: 121,880,571 S1085P probably damaging Het
Myo5b A G 18: 74,707,916 H956R probably benign Het
Ncoa7 A C 10: 30,701,992 L132R probably damaging Het
Ndufc1 T C 3: 51,408,243 T25A probably benign Het
Olfr1254 T C 2: 89,789,245 T36A probably damaging Het
Pkhd1l1 G A 15: 44,540,955 V2327M probably damaging Het
Ppp1r9b T C 11: 94,996,610 Y59H probably damaging Het
Sema4c A T 1: 36,553,534 F152I probably benign Het
Slit2 A T 5: 48,259,654 Y1016F probably damaging Het
Spata31d1c T A 13: 65,036,039 V465D probably benign Het
Ssc5d T C 7: 4,928,417 C208R probably damaging Het
Stambpl1 T G 19: 34,236,307 V312G probably benign Het
Stim1 T A 7: 102,354,541 D60E probably benign Het
Syt13 T A 2: 92,945,971 V201D probably benign Het
Tcaim G A 9: 122,818,773 probably null Het
Tex15 T C 8: 33,570,817 S366P possibly damaging Het
Tpte G A 8: 22,320,897 R190H probably benign Het
Vmn1r4 T C 6: 56,957,075 V188A probably damaging Het
Vmn2r88 A G 14: 51,416,787 D542G probably damaging Het
Vps33b T A 7: 80,284,353 I257N probably damaging Het
Wwox G T 8: 114,445,378 G71* probably null Het
Zc3h11a G T 1: 133,624,708 Q554K probably benign Het
Zfp947 T C 17: 22,146,093 K200R probably benign Het
Zscan12 T A 13: 21,368,986 C327S probably damaging Het
Other mutations in Atp12a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01382:Atp12a APN 14 56379955 missense probably damaging 1.00
IGL02108:Atp12a APN 14 56384068 missense possibly damaging 0.95
IGL02176:Atp12a APN 14 56387179 missense probably damaging 1.00
IGL02210:Atp12a APN 14 56371744 nonsense probably null
IGL02828:Atp12a APN 14 56376142 missense possibly damaging 0.72
IGL02868:Atp12a APN 14 56384182 missense probably damaging 1.00
IGL02876:Atp12a APN 14 56373289 missense probably benign 0.00
R0045:Atp12a UTSW 14 56372873 missense probably damaging 1.00
R0172:Atp12a UTSW 14 56372844 missense probably damaging 1.00
R0276:Atp12a UTSW 14 56387694 missense probably damaging 1.00
R0613:Atp12a UTSW 14 56374521 missense probably damaging 1.00
R0656:Atp12a UTSW 14 56374481 missense probably damaging 1.00
R0962:Atp12a UTSW 14 56368413 missense probably damaging 1.00
R1067:Atp12a UTSW 14 56373436 missense probably damaging 1.00
R1448:Atp12a UTSW 14 56385839 missense probably damaging 1.00
R1503:Atp12a UTSW 14 56373424 missense probably damaging 1.00
R1590:Atp12a UTSW 14 56380055 missense probably damaging 1.00
R1660:Atp12a UTSW 14 56370848 missense probably benign 0.21
R1696:Atp12a UTSW 14 56366088 missense probably damaging 1.00
R1775:Atp12a UTSW 14 56372589 missense probably benign 0.23
R1920:Atp12a UTSW 14 56386851 missense probably benign 0.19
R2022:Atp12a UTSW 14 56365282 start codon destroyed probably null
R2071:Atp12a UTSW 14 56366009 missense probably benign
R2253:Atp12a UTSW 14 56376258 missense probably benign 0.03
R2289:Atp12a UTSW 14 56373262 missense possibly damaging 0.93
R2567:Atp12a UTSW 14 56386927 missense probably damaging 1.00
R2870:Atp12a UTSW 14 56386950 missense possibly damaging 0.94
R2870:Atp12a UTSW 14 56386950 missense possibly damaging 0.94
R2872:Atp12a UTSW 14 56386950 missense possibly damaging 0.94
R2872:Atp12a UTSW 14 56386950 missense possibly damaging 0.94
R2873:Atp12a UTSW 14 56386950 missense possibly damaging 0.94
R2923:Atp12a UTSW 14 56374622 missense probably benign
R3736:Atp12a UTSW 14 56374427 missense possibly damaging 0.90
R3754:Atp12a UTSW 14 56372588 missense probably benign 0.01
R5028:Atp12a UTSW 14 56386978 missense probably damaging 0.96
R5267:Atp12a UTSW 14 56384211 missense probably damaging 1.00
R5481:Atp12a UTSW 14 56373389 missense possibly damaging 0.90
R5590:Atp12a UTSW 14 56373380 missense probably benign 0.11
R5842:Atp12a UTSW 14 56378290 missense probably damaging 0.96
R5899:Atp12a UTSW 14 56373344 missense probably benign 0.44
R5985:Atp12a UTSW 14 56384341 missense probably damaging 1.00
R6044:Atp12a UTSW 14 56376155 missense probably damaging 1.00
R6271:Atp12a UTSW 14 56378422 missense probably benign 0.00
R6454:Atp12a UTSW 14 56370833 missense probably benign 0.02
R6461:Atp12a UTSW 14 56373238 missense probably damaging 1.00
R6610:Atp12a UTSW 14 56374556 missense probably damaging 1.00
R6666:Atp12a UTSW 14 56373364 missense probably benign 0.36
R6667:Atp12a UTSW 14 56384188 missense possibly damaging 0.82
R6677:Atp12a UTSW 14 56380854 missense probably damaging 1.00
R6791:Atp12a UTSW 14 56386982 critical splice donor site probably null
R7003:Atp12a UTSW 14 56373380 missense possibly damaging 0.87
R7173:Atp12a UTSW 14 56384380 missense probably damaging 1.00
X0004:Atp12a UTSW 14 56378467 missense probably benign 0.16
Z1088:Atp12a UTSW 14 56386141 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- TGGAAGGCTGACTCCATGAAACAC -3'
(R):5'- CTTGCTTCTGGTCTCCCAGGAAAC -3'

Sequencing Primer
(F):5'- TCTTGGGAATAAGCACTGGAG -3'
(R):5'- CTGGCTACCAGGAAGATACTAC -3'
Posted On2014-04-24