Incidental Mutation 'R2571:Dzip3'
ID252599
Institutional Source Beutler Lab
Gene Symbol Dzip3
Ensembl Gene ENSMUSG00000064061
Gene NameDAZ interacting protein 3, zinc finger
Synonyms2A-HUB, 6430549P11Rik, 2310047C04Rik
MMRRC Submission 040429-MU
Accession Numbers

Genbank: NM_001110017.1, NM_027341.2; Ensembl: ENSMUST00000121869

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2571 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location48924232-48994165 bp(-) (GRCm38)
Type of Mutationsplice site (4 bp from exon)
DNA Base Change (assembly) T to C at 48972218 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000113344 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114516] [ENSMUST00000121869]
Predicted Effect probably null
Transcript: ENSMUST00000114516
SMART Domains Protein: ENSMUSP00000110161
Gene: ENSMUSG00000064061

DomainStartEndE-ValueType
low complexity region 451 472 N/A INTRINSIC
coiled coil region 548 568 N/A INTRINSIC
coiled coil region 599 650 N/A INTRINSIC
low complexity region 743 754 N/A INTRINSIC
low complexity region 883 891 N/A INTRINSIC
RING 938 977 2.09e-7 SMART
Predicted Effect probably null
Transcript: ENSMUST00000121869
SMART Domains Protein: ENSMUSP00000113344
Gene: ENSMUSG00000064061

DomainStartEndE-ValueType
low complexity region 657 678 N/A INTRINSIC
coiled coil region 754 774 N/A INTRINSIC
coiled coil region 805 856 N/A INTRINSIC
low complexity region 949 960 N/A INTRINSIC
low complexity region 1089 1097 N/A INTRINSIC
RING 1144 1183 2.09e-7 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-indcued allele exhibit embryonic lethality. [provided by MGI curators]
Allele List at MGI

All alleles(23) : Gene trapped(23)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,249,885 N2438S probably benign Het
Ago3 G A 4: 126,363,811 R476W probably damaging Het
Akap8 T C 17: 32,315,455 E339G probably damaging Het
Apba2 T C 7: 64,745,750 V658A probably damaging Het
BC049730 A G 7: 24,713,394 I76V probably benign Het
Bcl3 T C 7: 19,809,527 D338G probably damaging Het
Ccdc138 T C 10: 58,513,222 Y197H probably benign Het
Ccdc162 T A 10: 41,552,397 Q499L probably damaging Het
Ccser1 G A 6: 61,422,960 C21Y probably damaging Het
Chil6 A T 3: 106,390,393 Y229* probably null Het
Cntnap5a C T 1: 116,184,362 R461C probably damaging Het
Col19a1 T A 1: 24,374,631 R407S unknown Het
Crlf3 A T 11: 80,047,513 F433I probably benign Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Dnah10 A T 5: 124,775,478 R1867W probably damaging Het
Dsg3 T C 18: 20,540,005 V911A probably benign Het
Evpl T C 11: 116,237,969 Q10R unknown Het
Glra3 C T 8: 56,110,481 A337V probably benign Het
Gm8909 C T 17: 36,167,661 G132R possibly damaging Het
Hcfc2 T C 10: 82,709,023 F163S probably damaging Het
Hells T C 19: 38,959,733 V701A possibly damaging Het
Helz A G 11: 107,613,952 T422A probably benign Het
Hhat G A 1: 192,553,022 T442I probably damaging Het
Hmces A T 6: 87,936,220 Q319L possibly damaging Het
Ighv1-62-1 T A 12: 115,386,757 T97S probably damaging Het
Impad1 C T 4: 4,778,192 probably null Het
Kcne2 C T 16: 92,296,912 T109I probably damaging Het
Kcnq1 T G 7: 143,107,696 L113R probably benign Het
Kdm5d T C Y: 940,932 S1106P probably benign Het
Kel C A 6: 41,688,067 A588S possibly damaging Het
Kmt2e T A 5: 23,501,887 F1483I probably benign Het
Krt4 T A 15: 101,921,257 N279Y probably damaging Het
Lama4 T A 10: 39,042,675 M384K possibly damaging Het
Lepr C T 4: 101,768,172 T508I possibly damaging Het
Map1lc3b T A 8: 121,593,474 probably null Het
Me1 T C 9: 86,654,698 H108R probably damaging Het
Mindy4 T C 6: 55,284,785 S560P probably damaging Het
Mmp3 T A 9: 7,451,844 I394N possibly damaging Het
Mmrn2 T C 14: 34,402,939 S826P probably damaging Het
Olfr702 T A 7: 106,823,726 M267L probably benign Het
Osbpl7 T C 11: 97,054,841 L138P probably damaging Het
Pcdhga11 G A 18: 37,756,868 E310K probably damaging Het
Pcif1 A G 2: 164,884,211 D39G probably damaging Het
Ppp1r21 C T 17: 88,545,382 T63I probably benign Het
Prickle2 T C 6: 92,705,400 Q25R probably benign Het
Ptk2 A G 15: 73,231,919 L94P probably damaging Het
Ptprg T C 14: 12,122,135 F333S probably benign Het
Rag2 T A 2: 101,629,967 H207Q probably damaging Het
Rps6ka1 G T 4: 133,860,612 probably null Het
Rps6ka4 G T 19: 6,838,103 H174Q probably damaging Het
Rreb1 C A 13: 37,899,637 T92K probably damaging Het
Ryr1 A T 7: 29,009,562 M4793K unknown Het
Ryr1 T A 7: 29,036,126 M4076L possibly damaging Het
Sec16a A C 2: 26,439,331 S891A probably benign Het
Sgsh A G 11: 119,350,514 Y132H probably damaging Het
Sos2 T A 12: 69,635,718 E242V possibly damaging Het
Spata31d1c G T 13: 65,036,384 R580L probably damaging Het
Spata9 C A 13: 75,967,761 probably benign Het
Tead2 T A 7: 45,225,770 V202E probably damaging Het
Thada T C 17: 84,454,640 K168E probably damaging Het
Tmem64 T C 4: 15,266,718 I256T probably damaging Het
Tra2a G T 6: 49,252,487 probably benign Het
Trim30a T A 7: 104,429,326 N181I possibly damaging Het
Ttc13 A C 8: 124,683,799 Y372D probably damaging Het
Vit T C 17: 78,586,745 V192A probably benign Het
Vmn2r69 T C 7: 85,415,556 T41A probably benign Het
Vps13d C A 4: 145,149,136 K1600N probably benign Het
Xpnpep3 A T 15: 81,450,926 H420L probably damaging Het
Zfp322a A G 13: 23,356,444 L376P probably damaging Het
Zfp619 T C 7: 39,537,171 L875P probably damaging Het
Zic5 T A 14: 122,459,478 Q575L unknown Het
Other mutations in Dzip3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00825:Dzip3 APN 16 48928415 missense probably damaging 1.00
IGL00931:Dzip3 APN 16 48935497 critical splice donor site probably null
IGL01109:Dzip3 APN 16 48929674 missense probably benign 0.27
IGL01121:Dzip3 APN 16 48944881 missense probably benign 0.10
IGL01328:Dzip3 APN 16 48972258 missense probably damaging 1.00
IGL01729:Dzip3 APN 16 48928363 missense possibly damaging 0.78
IGL02044:Dzip3 APN 16 48948427 missense possibly damaging 0.90
IGL02051:Dzip3 APN 16 48972254 missense probably benign 0.01
IGL02115:Dzip3 APN 16 48948485 missense probably benign 0.00
IGL02125:Dzip3 APN 16 48927596 missense probably damaging 1.00
IGL02136:Dzip3 APN 16 48927582 missense possibly damaging 0.94
IGL02244:Dzip3 APN 16 48980988 missense probably benign 0.01
IGL02253:Dzip3 APN 16 48944924 missense probably benign 0.34
IGL02412:Dzip3 APN 16 48958457 missense probably benign 0.00
IGL02452:Dzip3 APN 16 48938537 splice site probably benign
IGL02481:Dzip3 APN 16 48975551 splice site probably benign
IGL02499:Dzip3 APN 16 48933850 missense probably damaging 1.00
IGL02511:Dzip3 APN 16 48936980 missense possibly damaging 0.75
IGL02519:Dzip3 APN 16 48928396 missense probably damaging 1.00
IGL02610:Dzip3 APN 16 48951653 missense probably damaging 1.00
IGL03129:Dzip3 APN 16 48942083 missense possibly damaging 0.51
IGL03342:Dzip3 APN 16 48929623 missense probably damaging 0.98
IGL03493:Dzip3 APN 16 48951696 missense probably benign 0.32
dazwick UTSW 16 48958465 missense possibly damaging 0.90
1mM(1):Dzip3 UTSW 16 48951557 missense probably damaging 1.00
PIT4651001:Dzip3 UTSW 16 48944878 missense probably benign
R0313:Dzip3 UTSW 16 48937061 missense probably damaging 0.99
R0483:Dzip3 UTSW 16 48947713 missense possibly damaging 0.94
R0504:Dzip3 UTSW 16 48959643 splice site probably benign
R0744:Dzip3 UTSW 16 48959675 missense probably damaging 1.00
R0800:Dzip3 UTSW 16 48953808 splice site probably benign
R0927:Dzip3 UTSW 16 48975477 missense probably damaging 0.99
R0931:Dzip3 UTSW 16 48951558 missense probably damaging 1.00
R1170:Dzip3 UTSW 16 48961208 missense probably damaging 1.00
R1203:Dzip3 UTSW 16 48951817 missense probably damaging 1.00
R1205:Dzip3 UTSW 16 48951681 missense probably damaging 1.00
R1442:Dzip3 UTSW 16 48945622 missense probably benign 0.19
R1526:Dzip3 UTSW 16 48937006 missense probably damaging 1.00
R1560:Dzip3 UTSW 16 48951540 splice site probably null
R1585:Dzip3 UTSW 16 48977878 splice site probably benign
R1682:Dzip3 UTSW 16 48958417 critical splice donor site probably null
R1957:Dzip3 UTSW 16 48927593 missense probably damaging 1.00
R2472:Dzip3 UTSW 16 48953787 missense possibly damaging 0.85
R3040:Dzip3 UTSW 16 48928324 missense probably damaging 1.00
R3081:Dzip3 UTSW 16 48927558 missense probably damaging 1.00
R3615:Dzip3 UTSW 16 48937063 missense probably damaging 1.00
R3616:Dzip3 UTSW 16 48937063 missense probably damaging 1.00
R3786:Dzip3 UTSW 16 48975543 missense probably benign 0.08
R3851:Dzip3 UTSW 16 48950013 missense possibly damaging 0.94
R4097:Dzip3 UTSW 16 48958489 nonsense probably null
R4371:Dzip3 UTSW 16 48943455 critical splice donor site probably null
R4612:Dzip3 UTSW 16 48952040 nonsense probably null
R4671:Dzip3 UTSW 16 48979590 nonsense probably null
R4695:Dzip3 UTSW 16 48951561 missense probably damaging 1.00
R4696:Dzip3 UTSW 16 48925969 unclassified probably benign
R4769:Dzip3 UTSW 16 48938474 missense probably damaging 0.97
R5063:Dzip3 UTSW 16 48953754 nonsense probably null
R5321:Dzip3 UTSW 16 48957675 missense possibly damaging 0.95
R5764:Dzip3 UTSW 16 48927361 intron probably benign
R6020:Dzip3 UTSW 16 48951842 missense probably damaging 1.00
R6218:Dzip3 UTSW 16 48958465 missense possibly damaging 0.90
R6300:Dzip3 UTSW 16 48951807 missense probably damaging 1.00
R6365:Dzip3 UTSW 16 48931273 missense probably damaging 0.96
R6778:Dzip3 UTSW 16 48982083 missense probably benign 0.00
R6915:Dzip3 UTSW 16 48942125 missense possibly damaging 0.72
R7047:Dzip3 UTSW 16 48982126 missense probably benign 0.04
R7059:Dzip3 UTSW 16 48980942 missense probably benign 0.34
R7095:Dzip3 UTSW 16 48927790 missense probably benign
R7227:Dzip3 UTSW 16 48951569 missense probably damaging 0.99
R7319:Dzip3 UTSW 16 48927540 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGACTGAACCCACACTCTGC -3'
(R):5'- TGACTACTACAACTCAGGACTGTC -3'

Sequencing Primer
(F):5'- CTCTGCACCAAGTAATGAAAATAAGG -3'
(R):5'- TTTCTACAGCATGCCAGAGG -3'
Posted On2014-12-04