Incidental Mutation 'R2872:Ctnnd1'
ID253842
Institutional Source Beutler Lab
Gene Symbol Ctnnd1
Ensembl Gene ENSMUSG00000034101
Gene Namecatenin (cadherin associated protein), delta 1
SynonymsP120, p120-catenin, Ctnnd, Catns
MMRRC Submission 040460-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2872 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location84600071-84650765 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 84620888 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 123 (V123I)
Ref Sequence ENSEMBL: ENSMUSP00000107323 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036811] [ENSMUST00000066177] [ENSMUST00000067232] [ENSMUST00000099941] [ENSMUST00000111670] [ENSMUST00000111675] [ENSMUST00000111676] [ENSMUST00000111677] [ENSMUST00000111678] [ENSMUST00000111684] [ENSMUST00000111685] [ENSMUST00000111686] [ENSMUST00000111687] [ENSMUST00000111688] [ENSMUST00000111689] [ENSMUST00000111690] [ENSMUST00000111691] [ENSMUST00000111692] [ENSMUST00000111693] [ENSMUST00000111694] [ENSMUST00000111695] [ENSMUST00000111696] [ENSMUST00000111697] [ENSMUST00000111698] [ENSMUST00000189772]
Predicted Effect probably benign
Transcript: ENSMUST00000036811
AA Change: V123I

PolyPhen 2 Score 0.315 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000042543
Gene: ENSMUSG00000034101
AA Change: V123I

DomainStartEndE-ValueType
coiled coil region 10 45 N/A INTRINSIC
low complexity region 126 153 N/A INTRINSIC
ARM 397 437 2.53e-6 SMART
ARM 440 481 2.8e-8 SMART
ARM 482 539 6.3e1 SMART
ARM 541 588 3.74e0 SMART
Blast:ARM 651 693 9e-20 BLAST
ARM 699 739 1.23e-4 SMART
ARM 789 831 4.41e1 SMART
low complexity region 857 868 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000066177
AA Change: V123I

PolyPhen 2 Score 0.315 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000065252
Gene: ENSMUSG00000034101
AA Change: V123I

DomainStartEndE-ValueType
coiled coil region 10 45 N/A INTRINSIC
low complexity region 126 153 N/A INTRINSIC
ARM 397 437 1.2e-8 SMART
ARM 440 481 1.3e-10 SMART
ARM 482 539 3e-1 SMART
ARM 541 588 1.8e-2 SMART
Blast:ARM 645 687 1e-19 BLAST
ARM 693 733 5.7e-7 SMART
ARM 783 825 2.1e-1 SMART
low complexity region 851 862 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000067232
AA Change: V123I

PolyPhen 2 Score 0.315 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000064518
Gene: ENSMUSG00000034101
AA Change: V123I

DomainStartEndE-ValueType
coiled coil region 10 45 N/A INTRINSIC
low complexity region 126 153 N/A INTRINSIC
ARM 397 437 2.53e-6 SMART
ARM 440 481 2.8e-8 SMART
ARM 482 539 6.3e1 SMART
ARM 541 588 3.74e0 SMART
Blast:ARM 651 693 9e-20 BLAST
ARM 699 739 1.23e-4 SMART
ARM 789 831 4.41e1 SMART
low complexity region 857 868 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099941
AA Change: V22I

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000097524
Gene: ENSMUSG00000034101
AA Change: V22I

DomainStartEndE-ValueType
low complexity region 25 52 N/A INTRINSIC
ARM 296 336 2.53e-6 SMART
ARM 339 380 2.8e-8 SMART
ARM 381 438 6.3e1 SMART
ARM 440 487 3.74e0 SMART
Blast:ARM 550 592 8e-20 BLAST
ARM 598 638 1.23e-4 SMART
ARM 688 730 4.41e1 SMART
low complexity region 756 767 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111670
AA Change: V22I

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000107299
Gene: ENSMUSG00000034101
AA Change: V22I

DomainStartEndE-ValueType
low complexity region 25 52 N/A INTRINSIC
ARM 296 336 2.53e-6 SMART
ARM 339 380 2.8e-8 SMART
ARM 381 438 6.3e1 SMART
ARM 440 487 3.74e0 SMART
Blast:ARM 544 586 9e-20 BLAST
ARM 592 632 1.23e-4 SMART
ARM 682 724 4.41e1 SMART
low complexity region 750 761 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111675
SMART Domains Protein: ENSMUSP00000107304
Gene: ENSMUSG00000034101

DomainStartEndE-ValueType
ARM 74 114 2.53e-6 SMART
ARM 117 158 2.8e-8 SMART
ARM 159 216 6.3e1 SMART
ARM 218 265 3.74e0 SMART
Blast:ARM 322 364 8e-20 BLAST
ARM 370 410 1.23e-4 SMART
ARM 460 502 4.41e1 SMART
low complexity region 528 539 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111676
AA Change: V22I

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000107305
Gene: ENSMUSG00000034101
AA Change: V22I

DomainStartEndE-ValueType
low complexity region 25 52 N/A INTRINSIC
ARM 296 336 2.53e-6 SMART
ARM 339 380 2.8e-8 SMART
ARM 381 438 6.3e1 SMART
ARM 440 487 3.74e0 SMART
Blast:ARM 544 586 1e-19 BLAST
ARM 592 632 1.23e-4 SMART
ARM 682 724 4.41e1 SMART
low complexity region 750 761 N/A INTRINSIC
low complexity region 836 848 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111677
AA Change: V22I

PolyPhen 2 Score 0.132 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000107306
Gene: ENSMUSG00000034101
AA Change: V22I

DomainStartEndE-ValueType
low complexity region 25 52 N/A INTRINSIC
ARM 296 336 2.53e-6 SMART
ARM 339 380 2.8e-8 SMART
ARM 381 438 6.3e1 SMART
ARM 440 487 3.74e0 SMART
ARM 592 632 1.23e-4 SMART
ARM 682 724 4.41e1 SMART
low complexity region 750 761 N/A INTRINSIC
low complexity region 815 827 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111678
AA Change: V22I

PolyPhen 2 Score 0.132 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000107307
Gene: ENSMUSG00000034101
AA Change: V22I

DomainStartEndE-ValueType
low complexity region 25 52 N/A INTRINSIC
ARM 296 336 2.53e-6 SMART
ARM 339 380 2.8e-8 SMART
ARM 381 438 6.3e1 SMART
ARM 440 487 3.74e0 SMART
Blast:ARM 550 592 9e-20 BLAST
ARM 598 638 1.23e-4 SMART
ARM 688 730 4.41e1 SMART
low complexity region 756 767 N/A INTRINSIC
low complexity region 842 854 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111684
AA Change: V69I

PolyPhen 2 Score 0.315 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000107313
Gene: ENSMUSG00000034101
AA Change: V69I

DomainStartEndE-ValueType
low complexity region 72 99 N/A INTRINSIC
ARM 343 383 2.53e-6 SMART
ARM 386 427 2.8e-8 SMART
ARM 428 485 6.3e1 SMART
ARM 487 534 3.74e0 SMART
Blast:ARM 597 639 6e-20 BLAST
ARM 645 685 1.23e-4 SMART
ARM 735 777 4.41e1 SMART
low complexity region 803 814 N/A INTRINSIC
low complexity region 889 901 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111685
AA Change: V69I

PolyPhen 2 Score 0.244 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000107314
Gene: ENSMUSG00000034101
AA Change: V69I

DomainStartEndE-ValueType
low complexity region 72 99 N/A INTRINSIC
ARM 343 383 2.53e-6 SMART
ARM 386 427 2.8e-8 SMART
ARM 428 485 6.3e1 SMART
ARM 487 534 3.74e0 SMART
Blast:ARM 597 639 6e-20 BLAST
ARM 645 685 1.23e-4 SMART
ARM 735 777 4.41e1 SMART
low complexity region 803 814 N/A INTRINSIC
low complexity region 868 880 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111686
AA Change: V69I

PolyPhen 2 Score 0.244 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000107315
Gene: ENSMUSG00000034101
AA Change: V69I

DomainStartEndE-ValueType
low complexity region 72 99 N/A INTRINSIC
ARM 343 383 2.53e-6 SMART
ARM 386 427 2.8e-8 SMART
ARM 428 485 6.3e1 SMART
ARM 487 534 3.74e0 SMART
Blast:ARM 591 633 7e-20 BLAST
ARM 639 679 1.23e-4 SMART
ARM 729 771 4.41e1 SMART
low complexity region 797 808 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111687
AA Change: V69I

PolyPhen 2 Score 0.244 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000107316
Gene: ENSMUSG00000034101
AA Change: V69I

DomainStartEndE-ValueType
low complexity region 72 99 N/A INTRINSIC
ARM 343 383 2.53e-6 SMART
ARM 386 427 2.8e-8 SMART
ARM 428 485 6.3e1 SMART
ARM 487 534 3.74e0 SMART
Blast:ARM 591 633 8e-20 BLAST
ARM 639 679 1.23e-4 SMART
ARM 729 771 4.41e1 SMART
low complexity region 797 808 N/A INTRINSIC
low complexity region 883 895 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111688
AA Change: V69I

PolyPhen 2 Score 0.244 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000107317
Gene: ENSMUSG00000034101
AA Change: V69I

DomainStartEndE-ValueType
low complexity region 72 99 N/A INTRINSIC
ARM 343 383 2.53e-6 SMART
ARM 386 427 2.8e-8 SMART
ARM 428 485 6.3e1 SMART
ARM 487 534 3.74e0 SMART
Blast:ARM 591 633 7e-20 BLAST
ARM 639 679 1.23e-4 SMART
ARM 729 771 4.41e1 SMART
low complexity region 797 808 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111689
AA Change: V69I

PolyPhen 2 Score 0.315 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000107318
Gene: ENSMUSG00000034101
AA Change: V69I

DomainStartEndE-ValueType
low complexity region 72 99 N/A INTRINSIC
ARM 343 383 2.53e-6 SMART
ARM 386 427 2.8e-8 SMART
ARM 428 485 6.3e1 SMART
ARM 487 534 3.74e0 SMART
Blast:ARM 597 639 6e-20 BLAST
ARM 645 685 1.23e-4 SMART
ARM 735 777 4.41e1 SMART
low complexity region 803 814 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111690
AA Change: V69I

PolyPhen 2 Score 0.244 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000107319
Gene: ENSMUSG00000034101
AA Change: V69I

DomainStartEndE-ValueType
low complexity region 72 99 N/A INTRINSIC
ARM 343 383 2.53e-6 SMART
ARM 386 427 2.8e-8 SMART
ARM 428 485 6.3e1 SMART
ARM 487 534 3.74e0 SMART
Blast:ARM 591 633 7e-20 BLAST
ARM 639 679 1.23e-4 SMART
ARM 729 771 4.41e1 SMART
low complexity region 797 808 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111691
AA Change: V123I

PolyPhen 2 Score 0.315 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000107320
Gene: ENSMUSG00000034101
AA Change: V123I

DomainStartEndE-ValueType
coiled coil region 10 45 N/A INTRINSIC
low complexity region 126 153 N/A INTRINSIC
ARM 397 437 2.53e-6 SMART
ARM 440 481 2.8e-8 SMART
ARM 482 539 6.3e1 SMART
ARM 541 588 3.74e0 SMART
Blast:ARM 651 693 9e-20 BLAST
ARM 699 739 1.23e-4 SMART
ARM 789 831 4.41e1 SMART
low complexity region 857 868 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111692
AA Change: V123I

PolyPhen 2 Score 0.315 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000107321
Gene: ENSMUSG00000034101
AA Change: V123I

DomainStartEndE-ValueType
coiled coil region 10 45 N/A INTRINSIC
low complexity region 126 153 N/A INTRINSIC
ARM 397 437 2.53e-6 SMART
ARM 440 481 2.8e-8 SMART
ARM 482 539 6.3e1 SMART
ARM 541 588 3.74e0 SMART
Blast:ARM 645 687 1e-19 BLAST
ARM 693 733 1.23e-4 SMART
ARM 783 825 4.41e1 SMART
low complexity region 851 862 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111693
AA Change: V123I

PolyPhen 2 Score 0.315 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000107322
Gene: ENSMUSG00000034101
AA Change: V123I

DomainStartEndE-ValueType
coiled coil region 10 45 N/A INTRINSIC
low complexity region 126 153 N/A INTRINSIC
ARM 397 437 2.53e-6 SMART
ARM 440 481 2.8e-8 SMART
ARM 482 539 6.3e1 SMART
ARM 541 588 3.74e0 SMART
Blast:ARM 645 687 1e-19 BLAST
ARM 693 733 1.23e-4 SMART
ARM 783 825 4.41e1 SMART
low complexity region 851 862 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000111694
AA Change: V123I

PolyPhen 2 Score 0.875 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000107323
Gene: ENSMUSG00000034101
AA Change: V123I

DomainStartEndE-ValueType
coiled coil region 10 45 N/A INTRINSIC
low complexity region 126 153 N/A INTRINSIC
ARM 397 437 2.53e-6 SMART
ARM 440 481 2.8e-8 SMART
ARM 482 539 6.3e1 SMART
ARM 541 588 3.74e0 SMART
Blast:ARM 651 693 9e-20 BLAST
ARM 699 739 1.23e-4 SMART
ARM 789 831 4.41e1 SMART
low complexity region 857 868 N/A INTRINSIC
low complexity region 943 955 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111695
AA Change: V123I

PolyPhen 2 Score 0.315 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000107324
Gene: ENSMUSG00000034101
AA Change: V123I

DomainStartEndE-ValueType
coiled coil region 10 45 N/A INTRINSIC
low complexity region 126 153 N/A INTRINSIC
ARM 397 437 2.53e-6 SMART
ARM 440 481 2.8e-8 SMART
ARM 482 539 6.3e1 SMART
ARM 541 588 3.74e0 SMART
Blast:ARM 645 687 1e-19 BLAST
ARM 693 733 1.23e-4 SMART
ARM 783 825 4.41e1 SMART
low complexity region 851 862 N/A INTRINSIC
low complexity region 937 949 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111696
AA Change: V123I

PolyPhen 2 Score 0.244 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000107325
Gene: ENSMUSG00000034101
AA Change: V123I

DomainStartEndE-ValueType
coiled coil region 10 45 N/A INTRINSIC
low complexity region 126 153 N/A INTRINSIC
ARM 397 437 2.53e-6 SMART
ARM 440 481 2.8e-8 SMART
ARM 482 539 6.3e1 SMART
ARM 541 588 3.74e0 SMART
Blast:ARM 645 687 1e-19 BLAST
ARM 693 733 1.23e-4 SMART
ARM 783 825 4.41e1 SMART
low complexity region 851 862 N/A INTRINSIC
low complexity region 916 928 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111697
AA Change: V123I

PolyPhen 2 Score 0.315 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000107326
Gene: ENSMUSG00000034101
AA Change: V123I

DomainStartEndE-ValueType
coiled coil region 10 45 N/A INTRINSIC
low complexity region 126 153 N/A INTRINSIC
ARM 397 437 2.53e-6 SMART
ARM 440 481 2.8e-8 SMART
ARM 482 539 6.3e1 SMART
ARM 541 588 3.74e0 SMART
Blast:ARM 651 693 9e-20 BLAST
ARM 699 739 1.23e-4 SMART
ARM 789 831 4.41e1 SMART
low complexity region 857 868 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111698
AA Change: V59I

PolyPhen 2 Score 0.244 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000107327
Gene: ENSMUSG00000034101
AA Change: V59I

DomainStartEndE-ValueType
low complexity region 62 89 N/A INTRINSIC
ARM 333 373 2.53e-6 SMART
ARM 376 417 2.8e-8 SMART
ARM 418 475 6.3e1 SMART
ARM 477 524 3.74e0 SMART
Blast:ARM 581 623 8e-20 BLAST
ARM 629 669 1.23e-4 SMART
ARM 719 761 4.41e1 SMART
low complexity region 787 798 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126092
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145312
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149317
Predicted Effect probably benign
Transcript: ENSMUST00000189772
AA Change: V123I

PolyPhen 2 Score 0.315 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000141166
Gene: ENSMUSG00000101645
AA Change: V123I

DomainStartEndE-ValueType
coiled coil region 10 45 N/A INTRINSIC
low complexity region 126 153 N/A INTRINSIC
ARM 397 437 2.53e-6 SMART
ARM 440 481 2.8e-8 SMART
ARM 482 539 6.3e1 SMART
ARM 541 588 3.74e0 SMART
Blast:ARM 651 693 9e-20 BLAST
ARM 699 739 1.23e-4 SMART
ARM 789 831 4.41e1 SMART
low complexity region 857 868 N/A INTRINSIC
Meta Mutation Damage Score 0.124 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.6%
  • 10x: 94.5%
  • 20x: 80.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Armadillo protein family, which function in adhesion between cells and signal transduction. Multiple translation initiation codons and alternative splicing result in many different isoforms being translated. Not all of the full-length natures of the described transcript variants have been determined. Read-through transcription also exists between this gene and the neighboring upstream thioredoxin-related transmembrane protein 2 (TMX2) gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Mice homozygous for disruptions of this gene die shortly after birth and have morphological abnormalities of the salivary glands and lacrimal gland. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A G 11: 109,955,176 C811R possibly damaging Het
AI481877 A C 4: 59,093,850 L226R probably damaging Het
Ak8 T C 2: 28,742,720 I317T possibly damaging Het
Als2 A G 1: 59,211,137 S483P probably damaging Het
Arhgef10 T C 8: 14,975,093 probably null Het
Arhgef10 A G 8: 14,975,666 I459V probably benign Het
Armc2 C T 10: 41,966,700 probably null Het
Atp12a A G 14: 56,386,950 R952G possibly damaging Het
Atp6v1g1 A G 4: 63,550,021 Y87C probably benign Het
Col12a1 A T 9: 79,699,549 F531I probably damaging Het
Csmd2 T C 4: 128,557,718 F113S unknown Het
Cyp4a14 C A 4: 115,487,301 G456W probably damaging Het
Cyp4a30b A G 4: 115,458,362 H260R possibly damaging Het
Eef2 GCCC GCCCC 10: 81,178,767 probably null Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Frmpd4 A T X: 167,477,247 D1166E probably benign Het
Gpr156 T A 16: 37,992,223 V307D probably damaging Het
Gpr35 G A 1: 92,983,126 V187I probably benign Het
Gria2 G A 3: 80,702,492 T670I probably damaging Het
Hdac10 G T 15: 89,125,856 Q300K possibly damaging Het
Hdhd2 T C 18: 76,955,006 F44L probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hmcn1 A T 1: 150,738,716 V1313D possibly damaging Het
Ick A T 9: 78,140,100 probably null Het
Ift172 C T 5: 31,257,861 V1335I probably benign Het
Igsf9b A G 9: 27,322,223 I340V probably benign Het
Kif1c A G 11: 70,724,081 E567G probably damaging Het
Klf8 A T X: 153,382,682 E82D probably damaging Het
Matr3 T A 18: 35,572,296 S91R probably benign Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Mtor T A 4: 148,540,030 M2089K probably benign Het
Myo9b T C 8: 71,290,966 Y224H probably benign Het
Nlrc3 T C 16: 3,957,326 D774G possibly damaging Het
Notum A G 11: 120,660,196 V48A probably benign Het
Nox3 T C 17: 3,682,916 H240R probably damaging Het
Nsun2 A G 13: 69,629,682 T425A probably damaging Het
Olfr1510 T G 14: 52,410,861 T4P probably benign Het
Olfr419 T C 1: 174,250,526 S134G probably benign Het
Olfr654 T C 7: 104,588,493 S230P possibly damaging Het
Olfr99 A G 17: 37,279,976 V148A possibly damaging Het
Ostc T C 3: 130,703,508 N80S probably damaging Het
Otud4 T A 8: 79,661,073 N300K possibly damaging Het
Palmd T C 3: 116,923,751 R366G possibly damaging Het
Paqr5 A T 9: 61,968,779 probably null Het
Parp1 A G 1: 180,573,665 D45G probably damaging Het
Pcdhga9 T A 18: 37,737,471 Y118N possibly damaging Het
Pkd1l2 C T 8: 117,038,164 V1332I probably benign Het
Plcl1 A T 1: 55,697,150 D550V probably benign Het
Plekhg1 T G 10: 3,963,982 S1235A probably benign Het
Plekhg5 T A 4: 152,107,503 C433S probably benign Het
Plin2 A G 4: 86,668,678 M1T probably null Het
Polg2 A G 11: 106,775,425 probably null Het
Ppp1r7 T A 1: 93,357,863 probably null Het
Prdx4 A G X: 155,340,464 V15A probably benign Het
Rapgef6 T A 11: 54,661,175 F956L probably damaging Het
Rasl12 A G 9: 65,408,323 N83S probably benign Het
Rel T C 11: 23,761,129 I13V probably benign Het
Reln C T 5: 22,049,791 V527I possibly damaging Het
Sel1l3 C T 5: 53,137,883 W792* probably null Het
Slc39a8 T A 3: 135,886,793 probably null Het
Slc6a9 T A 4: 117,849,381 M1K probably null Het
Smpdl3a T A 10: 57,802,530 F143Y possibly damaging Het
Spsb4 G T 9: 96,996,018 T84K probably damaging Het
Tbc1d8 A G 1: 39,405,317 F187S probably damaging Het
Tdpoz3 T A 3: 93,826,428 F137I probably benign Het
Tgm7 G A 2: 121,109,693 probably benign Het
Tnni3k C T 3: 154,938,750 probably null Het
Tpd52 A T 3: 9,003,406 Y16* probably null Het
Trpa1 A G 1: 14,887,620 C705R probably damaging Het
Ttn A G 2: 76,750,851 S23233P probably damaging Het
Uevld T C 7: 46,947,945 D154G probably null Het
Ugt1a1 AT A 1: 88,212,371 probably null Het
Zfp292 G A 4: 34,808,595 T1483M probably damaging Het
Other mutations in Ctnnd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00578:Ctnnd1 APN 2 84609625 missense probably damaging 0.99
IGL00846:Ctnnd1 APN 2 84622010 critical splice donor site probably null
IGL00861:Ctnnd1 APN 2 84603752 missense probably damaging 0.97
IGL01394:Ctnnd1 APN 2 84605256 splice site probably benign
IGL02035:Ctnnd1 APN 2 84620081 missense probably damaging 1.00
IGL02536:Ctnnd1 APN 2 84605196 missense probably benign 0.00
IGL02859:Ctnnd1 APN 2 84619909 splice site probably benign
IGL03270:Ctnnd1 APN 2 84609727 splice site probably null
IGL02802:Ctnnd1 UTSW 2 84624462 start codon destroyed probably null 0.99
R0449:Ctnnd1 UTSW 2 84603262 missense possibly damaging 0.53
R0487:Ctnnd1 UTSW 2 84609067 missense probably damaging 1.00
R0652:Ctnnd1 UTSW 2 84602896 missense probably benign 0.40
R1503:Ctnnd1 UTSW 2 84605179 splice site probably null
R1701:Ctnnd1 UTSW 2 84608991 missense probably damaging 1.00
R1796:Ctnnd1 UTSW 2 84615209 missense probably damaging 1.00
R2001:Ctnnd1 UTSW 2 84620360 missense probably benign 0.00
R2002:Ctnnd1 UTSW 2 84620360 missense probably benign 0.00
R2185:Ctnnd1 UTSW 2 84612548 missense probably damaging 1.00
R2192:Ctnnd1 UTSW 2 84609563 missense probably damaging 1.00
R2203:Ctnnd1 UTSW 2 84616680 missense probably damaging 1.00
R2389:Ctnnd1 UTSW 2 84624271 missense probably null 0.94
R2872:Ctnnd1 UTSW 2 84620888 missense possibly damaging 0.88
R3846:Ctnnd1 UTSW 2 84616927 missense probably benign 0.04
R4019:Ctnnd1 UTSW 2 84619958 missense probably damaging 1.00
R4194:Ctnnd1 UTSW 2 84603701 missense possibly damaging 0.93
R4796:Ctnnd1 UTSW 2 84619926 missense probably damaging 1.00
R4847:Ctnnd1 UTSW 2 84622052 nonsense probably null
R4964:Ctnnd1 UTSW 2 84622073 missense possibly damaging 0.85
R4966:Ctnnd1 UTSW 2 84622073 missense possibly damaging 0.85
R5223:Ctnnd1 UTSW 2 84616789 missense probably damaging 1.00
R5336:Ctnnd1 UTSW 2 84616789 missense probably damaging 1.00
R5428:Ctnnd1 UTSW 2 84616789 missense probably damaging 1.00
R5429:Ctnnd1 UTSW 2 84616789 missense probably damaging 1.00
R5974:Ctnnd1 UTSW 2 84620915 nonsense probably null
R6018:Ctnnd1 UTSW 2 84650468 intron probably benign
R6285:Ctnnd1 UTSW 2 84613887 critical splice donor site probably null
R6562:Ctnnd1 UTSW 2 84624308 missense probably benign
R6661:Ctnnd1 UTSW 2 84609642 missense probably damaging 1.00
R6694:Ctnnd1 UTSW 2 84624505 start gained probably benign
R6769:Ctnnd1 UTSW 2 84619925 missense probably damaging 1.00
R6769:Ctnnd1 UTSW 2 84620110 missense probably damaging 1.00
R6771:Ctnnd1 UTSW 2 84619925 missense probably damaging 1.00
R6771:Ctnnd1 UTSW 2 84620110 missense probably damaging 1.00
R6916:Ctnnd1 UTSW 2 84609646 missense probably benign 0.02
X0062:Ctnnd1 UTSW 2 84615214 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCGGAAGCTACTGTAACTGTC -3'
(R):5'- AGAGGCACCTGTGTTTCTTAC -3'

Sequencing Primer
(F):5'- GGAAGCTACTGTAACTGTCATACTCC -3'
(R):5'- GGCACCTGTGTTTCTTACTAGAATAG -3'
Posted On2014-12-04