Incidental Mutation 'R2566:Fam149b'
ID254499
Institutional Source Beutler Lab
Gene Symbol Fam149b
Ensembl Gene ENSMUSG00000039599
Gene Namefamily with sequence similarity 149, member B
Synonyms
MMRRC Submission 040425-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.297) question?
Stock #R2566 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location20348162-20383491 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 20375510 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 138 (M138L)
Ref Sequence ENSEMBL: ENSMUSP00000153332 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051915] [ENSMUST00000090499] [ENSMUST00000090503] [ENSMUST00000224721] [ENSMUST00000225597] [ENSMUST00000225834] [ENSMUST00000225942] [ENSMUST00000225991]
Predicted Effect probably benign
Transcript: ENSMUST00000051915
AA Change: M288L

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000056907
Gene: ENSMUSG00000039599
AA Change: M288L

DomainStartEndE-ValueType
Pfam:DUF3719 116 183 2.2e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000090499
AA Change: M342L

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000087985
Gene: ENSMUSG00000039599
AA Change: M342L

DomainStartEndE-ValueType
Pfam:DUF3719 116 181 1.5e-28 PFAM
low complexity region 369 383 N/A INTRINSIC
low complexity region 404 415 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090503
AA Change: M249L

PolyPhen 2 Score 0.220 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000087989
Gene: ENSMUSG00000039599
AA Change: M249L

DomainStartEndE-ValueType
Pfam:DUF3719 116 157 5.7e-14 PFAM
low complexity region 276 290 N/A INTRINSIC
low complexity region 311 322 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223898
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224079
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224670
Predicted Effect probably benign
Transcript: ENSMUST00000224721
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225114
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225363
Predicted Effect probably benign
Transcript: ENSMUST00000225597
Predicted Effect probably benign
Transcript: ENSMUST00000225834
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225837
Predicted Effect probably benign
Transcript: ENSMUST00000225942
AA Change: M342L

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
Predicted Effect probably damaging
Transcript: ENSMUST00000225991
AA Change: M138L

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T C 9: 124,293,071 K408E probably damaging Het
2010315B03Rik T A 9: 124,293,153 K380N probably damaging Het
9230104M06Rik C T 12: 113,000,739 probably benign Het
Ahi1 T A 10: 20,970,911 C413* probably null Het
Alms1 T A 6: 85,622,482 M1430K possibly damaging Het
Ankrd52 G T 10: 128,389,351 A894S probably benign Het
Arhgap33 C A 7: 30,527,229 V494L probably damaging Het
Atic G T 1: 71,568,971 V275F probably damaging Het
Atoh1 T A 6: 64,729,684 V121E probably damaging Het
Atp5h T A 11: 115,416,038 probably null Het
Baiap2l2 A T 15: 79,261,974 probably null Het
Brca2 A T 5: 150,541,762 T1664S probably benign Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Celf3 ACAGCAGCAGCAGCAGCAGCAGCA ACAGCAGCAGCAGCAGCAGCA 3: 94,488,230 probably benign Het
Cep350 A T 1: 155,959,718 probably null Het
Ces2g T C 8: 104,965,989 probably null Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Cyp2d34 A G 15: 82,616,167 F457S probably damaging Het
Disp3 T A 4: 148,241,423 T1293S probably damaging Het
Dock10 T A 1: 80,540,253 I1348F possibly damaging Het
Dsp A T 13: 38,196,404 H1776L probably damaging Het
Efhd1 A T 1: 87,309,755 Q228L possibly damaging Het
Entpd2 T A 2: 25,399,283 I259N probably benign Het
Fastkd5 T C 2: 130,616,365 K102E probably benign Het
Fzd7 C A 1: 59,484,536 T526K possibly damaging Het
G6pd2 T A 5: 61,808,987 I35N probably damaging Het
Gars T A 6: 55,065,563 M427K probably damaging Het
Gimap4 C T 6: 48,690,865 R57C probably damaging Het
Gm11232 C A 4: 71,757,785 W41L probably benign Het
Gm15737 T A 6: 92,879,720 C43* probably null Het
Gm853 A T 4: 130,209,888 L420Q probably benign Het
Gpr180 T C 14: 118,139,773 V62A probably benign Het
H2-M11 C T 17: 36,548,150 T194I possibly damaging Het
Jakmip3 A T 7: 138,989,468 E27V possibly damaging Het
Kcnq3 T C 15: 66,031,427 T145A probably damaging Het
Krt8 A G 15: 101,998,024 M350T probably benign Het
Krtap4-9 T A 11: 99,785,666 probably benign Het
Lbr G T 1: 181,836,127 D109E probably damaging Het
Med23 A G 10: 24,888,575 H42R probably damaging Het
Mgat5 A T 1: 127,307,004 M77L probably benign Het
Mlf1 A T 3: 67,384,586 N28I possibly damaging Het
Mroh3 A C 1: 136,198,126 L343R probably damaging Het
Mrpl37 T A 4: 107,064,493 I180F possibly damaging Het
Mrps27 T A 13: 99,400,328 C116* probably null Het
Muc6 A G 7: 141,640,384 S1354P possibly damaging Het
Myh7 A T 14: 54,983,242 D1033E probably damaging Het
Myo16 A T 8: 10,594,820 E1717D probably benign Het
Myo1g T A 11: 6,512,539 probably null Het
Olfr610 A G 7: 103,506,160 M262T probably benign Het
Olfr815 A C 10: 129,902,095 L205R probably damaging Het
Pan2 T C 10: 128,313,897 L576P probably damaging Het
Parp8 A G 13: 116,895,687 S278P possibly damaging Het
Pdk2 A G 11: 95,027,202 probably null Het
Phf1 T C 17: 26,937,088 S450P probably damaging Het
Pkd1l2 T C 8: 117,019,494 Y1919C probably damaging Het
Postn T A 3: 54,376,953 S614T probably damaging Het
Psmg1 A T 16: 95,982,195 Y213* probably null Het
Rab11b T A 17: 33,747,718 T203S probably benign Het
Rad54l2 T A 9: 106,703,626 T899S possibly damaging Het
Ramp2 TTGCTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTG 11: 101,246,545 probably benign Het
Rapgef6 A G 11: 54,687,711 T1028A possibly damaging Het
Rbm6 A G 9: 107,791,998 S58P possibly damaging Het
Rreb1 G T 13: 37,929,792 A376S possibly damaging Het
Rsbn1l T A 5: 20,919,769 N345I probably benign Het
Sf3b2 A T 19: 5,275,090 S785T possibly damaging Het
Sh2b1 C T 7: 126,468,926 D519N probably damaging Het
Slitrk6 T C 14: 110,750,272 T668A probably benign Het
Stkld1 T A 2: 26,950,638 I444N probably damaging Het
Sucla2 A T 14: 73,552,804 probably benign Het
Tmem67 T A 4: 12,079,918 L190F probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trem2 G A 17: 48,351,835 W191* probably null Het
Ube2d4 A T 15: 58,846,679 noncoding transcript Het
Uimc1 G T 13: 55,075,804 D218E probably damaging Het
Wdr62 A T 7: 30,273,999 V95E probably damaging Het
Zfhx4 T C 3: 5,245,143 V862A probably damaging Het
Zfp462 T A 4: 55,008,522 S163T probably benign Het
Zfp704 T C 3: 9,609,493 D76G unknown Het
Other mutations in Fam149b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01153:Fam149b APN 14 20377881 missense possibly damaging 0.78
IGL02323:Fam149b APN 14 20363301 missense possibly damaging 0.94
IGL02631:Fam149b APN 14 20375546 missense probably damaging 0.97
IGL03208:Fam149b APN 14 20351302 splice site probably benign
R0334:Fam149b UTSW 14 20363424 missense probably damaging 0.97
R2511:Fam149b UTSW 14 20378456 missense probably damaging 1.00
R4659:Fam149b UTSW 14 20367873 missense probably benign 0.16
R5011:Fam149b UTSW 14 20363371 missense possibly damaging 0.92
R5013:Fam149b UTSW 14 20363371 missense possibly damaging 0.92
R5583:Fam149b UTSW 14 20363300 missense possibly damaging 0.66
R5791:Fam149b UTSW 14 20351326 missense probably damaging 0.96
R5905:Fam149b UTSW 14 20359910 missense probably benign 0.30
R6035:Fam149b UTSW 14 20377917 missense probably damaging 1.00
R6035:Fam149b UTSW 14 20377917 missense probably damaging 1.00
R7180:Fam149b UTSW 14 20381785 missense probably benign 0.01
R7210:Fam149b UTSW 14 20378472 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGTGACCATTAAGTGCTCTCATC -3'
(R):5'- AGATAACCGAGCTGCTTTCC -3'

Sequencing Primer
(F):5'- CCATTAAGTGCTCTCATCTGAATTG -3'
(R):5'- GATAACCGAGCTGCTTTCCCTTTTC -3'
Posted On2014-12-04