Incidental Mutation 'R2895:Ttll4'
ID260729
Institutional Source Beutler Lab
Gene Symbol Ttll4
Ensembl Gene ENSMUSG00000033257
Gene Nametubulin tyrosine ligase-like family, member 4
Synonyms4632407P03Rik
MMRRC Submission 040483-MU
Accession Numbers

Genbank: NM_001014974.1; Ensembl: ENSMUST00000042125

Is this an essential gene? Possibly non essential (E-score: 0.323) question?
Stock #R2895 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location74661745-74703730 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 74685358 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 562 (H562Q)
Ref Sequence ENSEMBL: ENSMUSP00000109308 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042125] [ENSMUST00000113678] [ENSMUST00000129890] [ENSMUST00000141119]
Predicted Effect probably benign
Transcript: ENSMUST00000042125
AA Change: H562Q

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000037406
Gene: ENSMUSG00000033257
AA Change: H562Q

DomainStartEndE-ValueType
low complexity region 504 544 N/A INTRINSIC
Pfam:TTL 645 940 2.2e-106 PFAM
low complexity region 942 961 N/A INTRINSIC
low complexity region 1103 1113 N/A INTRINSIC
low complexity region 1168 1182 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000113678
AA Change: H562Q

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000109308
Gene: ENSMUSG00000033257
AA Change: H562Q

DomainStartEndE-ValueType
low complexity region 504 544 N/A INTRINSIC
Pfam:TTL 636 876 3.4e-82 PFAM
low complexity region 878 897 N/A INTRINSIC
low complexity region 1039 1049 N/A INTRINSIC
low complexity region 1104 1118 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129890
SMART Domains Protein: ENSMUSP00000119964
Gene: ENSMUSG00000033257

DomainStartEndE-ValueType
low complexity region 69 101 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140591
Predicted Effect probably benign
Transcript: ENSMUST00000141119
SMART Domains Protein: ENSMUSP00000116733
Gene: ENSMUSG00000033257

DomainStartEndE-ValueType
low complexity region 56 96 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143925
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145132
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155753
Meta Mutation Damage Score 0.062 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI

All alleles(20) : Targeted, other(2) Gene trapped(18)

Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415L06Rik A G X: 89,932,399 M64T possibly damaging Het
Abca6 A G 11: 110,202,426 V1007A probably benign Het
Abhd14b C T 9: 106,450,114 R32C probably benign Het
Akirin1 T C 4: 123,738,071 E168G probably damaging Het
Apol7e A T 15: 77,714,467 D44V possibly damaging Het
Asic1 A G 15: 99,696,602 I310V probably benign Het
Atp6v0a1 A G 11: 101,044,598 H661R probably benign Het
Caskin1 A G 17: 24,489,042 R25G probably damaging Het
Cd96 G T 16: 46,117,805 T99K probably benign Het
Cep250 C A 2: 155,992,122 A1989D probably benign Het
Clasp1 T G 1: 118,459,838 V78G probably damaging Het
Col15a1 T C 4: 47,312,091 V1302A possibly damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cyb5r4 C T 9: 87,040,399 Q154* probably null Het
Dnah7b T C 1: 46,139,741 F858S probably damaging Het
Dysf G A 6: 84,186,509 probably null Het
Gpr1 T A 1: 63,183,162 I305L probably benign Het
H3f3a C T 1: 180,803,138 R117H probably benign Het
Igkv1-135 T A 6: 67,610,348 S68T probably benign Het
Kmt2d G A 15: 98,843,939 probably benign Het
Lonp1 A G 17: 56,615,562 L688P probably damaging Het
Lpar6 A G 14: 73,239,276 K226E probably damaging Het
Map3k19 T C 1: 127,822,098 D968G possibly damaging Het
Med16 G A 10: 79,903,171 probably null Het
Mrc2 G A 11: 105,348,431 probably null Het
Mrps7 A G 11: 115,605,039 M98V probably benign Het
Ms4a14 A T 19: 11,304,231 I321N possibly damaging Het
Muc5ac A G 7: 141,791,140 D116G possibly damaging Het
Neu1 A G 17: 34,932,782 D184G probably benign Het
Nolc1 CCAGCAGCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGCAGCAGCAGCAGC 19: 46,081,352 probably benign Het
Olfr748 T C 14: 50,710,516 F62S probably damaging Het
Pcdh19 CTGTCTCCTCCA C X: 133,681,308 probably null Het
Pcdh19 TGTCTCCTCCACGTC TGTC X: 133,681,309 probably null Het
Plcz1 A G 6: 140,023,151 I187T possibly damaging Het
Pot1b A T 17: 55,687,939 I241N probably damaging Het
Ptpre G A 7: 135,643,858 W11* probably null Het
Rgsl1 T A 1: 153,827,548 E154V probably damaging Het
Rnasel T C 1: 153,760,776 I634T probably damaging Het
Scn10a A T 9: 119,661,401 S492T probably benign Het
Sec24d T A 3: 123,343,151 V511E probably damaging Het
Slc7a1 A G 5: 148,340,592 I371T probably benign Het
Smg1 A G 7: 118,189,143 probably benign Het
Sntg2 A T 12: 30,226,846 S402R probably benign Het
Stfa3 C A 16: 36,452,160 L59F probably benign Het
Tlr3 T C 8: 45,397,592 E756G possibly damaging Het
Other mutations in Ttll4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01606:Ttll4 APN 1 74685893 missense probably damaging 1.00
IGL01743:Ttll4 APN 1 74688193 missense possibly damaging 0.63
IGL01914:Ttll4 APN 1 74679058 missense probably benign 0.01
IGL02288:Ttll4 APN 1 74679401 missense probably benign 0.05
IGL02621:Ttll4 APN 1 74687484 missense probably damaging 1.00
IGL02662:Ttll4 APN 1 74687231 unclassified probably null
IGL02890:Ttll4 APN 1 74687339 nonsense probably null
IGL02937:Ttll4 APN 1 74679503 missense possibly damaging 0.92
IGL03178:Ttll4 APN 1 74680408 missense probably damaging 0.96
IGL03412:Ttll4 APN 1 74687321 missense probably benign 0.28
1mM(1):Ttll4 UTSW 1 74689980 missense probably null 1.00
R0083:Ttll4 UTSW 1 74679769 missense probably benign 0.13
R0108:Ttll4 UTSW 1 74679769 missense probably benign 0.13
R0135:Ttll4 UTSW 1 74679928 missense possibly damaging 0.86
R0137:Ttll4 UTSW 1 74679692 missense possibly damaging 0.74
R0306:Ttll4 UTSW 1 74696757 missense probably benign 0.28
R0506:Ttll4 UTSW 1 74688618 missense probably benign 0.06
R0555:Ttll4 UTSW 1 74688280 missense probably damaging 1.00
R1617:Ttll4 UTSW 1 74679401 missense probably benign 0.05
R1649:Ttll4 UTSW 1 74697470 missense possibly damaging 0.52
R1793:Ttll4 UTSW 1 74687840 missense possibly damaging 0.91
R1898:Ttll4 UTSW 1 74697482 missense probably benign 0.01
R1952:Ttll4 UTSW 1 74687559 missense probably damaging 0.99
R1987:Ttll4 UTSW 1 74685368 missense possibly damaging 0.81
R1989:Ttll4 UTSW 1 74685368 missense possibly damaging 0.81
R2067:Ttll4 UTSW 1 74680382 missense possibly damaging 0.94
R2162:Ttll4 UTSW 1 74686391 missense probably damaging 1.00
R2185:Ttll4 UTSW 1 74679829 missense possibly damaging 0.54
R2875:Ttll4 UTSW 1 74686438 unclassified probably null
R2876:Ttll4 UTSW 1 74686438 unclassified probably null
R2896:Ttll4 UTSW 1 74685358 missense possibly damaging 0.92
R3157:Ttll4 UTSW 1 74697611 missense possibly damaging 0.81
R3832:Ttll4 UTSW 1 74686391 missense probably damaging 1.00
R4707:Ttll4 UTSW 1 74679007 missense possibly damaging 0.62
R4784:Ttll4 UTSW 1 74679007 missense possibly damaging 0.62
R4785:Ttll4 UTSW 1 74679007 missense possibly damaging 0.62
R5176:Ttll4 UTSW 1 74679286 missense probably damaging 0.99
R5202:Ttll4 UTSW 1 74687852 critical splice donor site probably null
R5244:Ttll4 UTSW 1 74696448 missense probably benign 0.30
R5264:Ttll4 UTSW 1 74686376 missense possibly damaging 0.92
R5452:Ttll4 UTSW 1 74679321 missense probably benign 0.06
R5992:Ttll4 UTSW 1 74685391 missense probably damaging 1.00
R6111:Ttll4 UTSW 1 74697539 missense possibly damaging 0.95
R6722:Ttll4 UTSW 1 74681789 missense possibly damaging 0.95
R6776:Ttll4 UTSW 1 74681353 missense probably damaging 1.00
R6815:Ttll4 UTSW 1 74679349 missense possibly damaging 0.89
R6836:Ttll4 UTSW 1 74689413 missense probably damaging 0.98
R6963:Ttll4 UTSW 1 74681816 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATAACTGTAGGTAGGCTAGCTCTAG -3'
(R):5'- CCGTGTGAACTGAGCTCAAG -3'

Sequencing Primer
(F):5'- AGCTCTAGCACTGTATGAGCTC -3'
(R):5'- TACCTTAACAGCCATTCCGG -3'
Posted On2015-01-23