Incidental Mutation 'R5244:Ttll4'
ID401025
Institutional Source Beutler Lab
Gene Symbol Ttll4
Ensembl Gene ENSMUSG00000033257
Gene Nametubulin tyrosine ligase-like family, member 4
Synonyms4632407P03Rik
MMRRC Submission 042815-MU
Accession Numbers

Genbank: NM_001014974.1; Ensembl: ENSMUST00000042125

Is this an essential gene? Possibly non essential (E-score: 0.323) question?
Stock #R5244 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location74661745-74703730 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 74696448 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1005 (V1005A)
Ref Sequence ENSEMBL: ENSMUSP00000037406 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042125] [ENSMUST00000113678]
Predicted Effect probably benign
Transcript: ENSMUST00000042125
AA Change: V1005A

PolyPhen 2 Score 0.299 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000037406
Gene: ENSMUSG00000033257
AA Change: V1005A

DomainStartEndE-ValueType
low complexity region 504 544 N/A INTRINSIC
Pfam:TTL 645 940 2.2e-106 PFAM
low complexity region 942 961 N/A INTRINSIC
low complexity region 1103 1113 N/A INTRINSIC
low complexity region 1168 1182 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000113678
AA Change: V941A
SMART Domains Protein: ENSMUSP00000109308
Gene: ENSMUSG00000033257
AA Change: V941A

DomainStartEndE-ValueType
low complexity region 504 544 N/A INTRINSIC
Pfam:TTL 636 876 3.4e-82 PFAM
low complexity region 878 897 N/A INTRINSIC
low complexity region 1039 1049 N/A INTRINSIC
low complexity region 1104 1118 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128891
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143790
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145132
Meta Mutation Damage Score 0.328 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 97% (63/65)
Allele List at MGI

All alleles(20) : Targeted, other(2) Gene trapped(18)

Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930550C14Rik G T 9: 53,411,798 G45W probably damaging Het
Abca13 C T 11: 9,275,081 T520I probably benign Het
Adamtsl3 C T 7: 82,598,069 P485L probably benign Het
Bbof1 A C 12: 84,430,073 E492A possibly damaging Het
Capn11 T C 17: 45,633,892 E483G probably damaging Het
Cbs C T 17: 31,617,160 G438D probably damaging Het
Chil6 A G 3: 106,389,974 Y284H probably damaging Het
Cops4 C A 5: 100,533,375 Q131K probably benign Het
Cul4a T C 8: 13,146,566 I740T probably damaging Het
Cyfip1 C T 7: 55,925,199 T1066I probably damaging Het
Dnah7b T C 1: 46,233,858 L2382P probably damaging Het
Ehd3 A T 17: 73,830,000 H388L probably benign Het
Fam13a G T 6: 58,953,474 Y484* probably null Het
Gm5117 A G 8: 31,738,277 noncoding transcript Het
Gulp1 G A 1: 44,788,453 D260N probably damaging Het
Hhipl1 T A 12: 108,312,134 N240K probably damaging Het
Hydin A T 8: 110,532,819 E2474D possibly damaging Het
Ifi207 C T 1: 173,729,937 V412I probably benign Het
Ighv9-4 T C 12: 114,300,251 I21V probably benign Het
Kcnh1 A T 1: 192,224,876 T79S probably benign Het
Kpna6 A G 4: 129,655,428 probably null Het
Lnpk C T 2: 74,531,888 G262D probably damaging Het
Lsm7 T C 10: 80,853,073 E66G probably benign Het
Mbd3l1 T A 9: 18,484,637 C19* probably null Het
Mfsd6l T A 11: 68,557,175 L284Q possibly damaging Het
Naip5 C T 13: 100,245,662 V180I probably benign Het
Olfr1037 C G 2: 86,084,956 A274P probably damaging Het
Olfr1285 T A 2: 111,408,554 noncoding transcript Het
Olfr213 T A 6: 116,541,226 Y258N probably damaging Het
Olfr44 T G 9: 39,484,512 H247P probably damaging Het
Olfr531 A T 7: 140,400,138 C303S probably benign Het
Olfr694 T A 7: 106,689,189 I181F probably benign Het
Olfr837 A T 9: 19,137,851 N286I probably damaging Het
Pck1 T A 2: 173,154,863 I190N possibly damaging Het
Pfkfb3 T A 2: 11,484,849 I209F probably damaging Het
Phc1 A G 6: 122,321,979 S677P probably damaging Het
Pirb G A 7: 3,716,063 A609V probably benign Het
Plag1 A T 4: 3,903,887 S435T probably benign Het
Plscr2 C G 9: 92,291,049 L215V probably benign Het
Pnmal1 A G 7: 16,961,323 S368G probably damaging Het
Polr2b A G 5: 77,343,000 probably benign Het
Pthlh T C 6: 147,257,153 Y103C probably damaging Het
Ptprq A G 10: 107,586,695 V1612A possibly damaging Het
Rprd2 T A 3: 95,790,182 I85L possibly damaging Het
Slc27a2 T C 2: 126,578,855 V422A probably benign Het
Slc29a1 T C 17: 45,588,413 probably benign Het
Slc36a4 A T 9: 15,734,278 I334F probably benign Het
Slc4a10 T A 2: 62,288,725 S761R probably damaging Het
Spa17 T A 9: 37,611,989 M1L probably damaging Het
Srsf11 C T 3: 158,023,344 probably benign Het
Stk19 A G 17: 34,832,070 L72P probably damaging Het
Trhde T C 10: 114,801,081 M74V probably benign Het
Trim37 C T 11: 87,218,257 H937Y probably benign Het
Ttc7b A G 12: 100,348,010 L46P probably damaging Het
Ugt2b36 T C 5: 87,091,906 T207A probably damaging Het
Unc13c C T 9: 73,525,951 probably null Het
Vmn1r221 T C 13: 23,217,638 noncoding transcript Het
Vmn2r101 T C 17: 19,611,526 S595P probably damaging Het
Wnt10a T C 1: 74,803,295 L310P probably damaging Het
Yif1b G A 7: 29,244,441 A115T probably damaging Het
Zfp219 C A 14: 52,008,542 R331L possibly damaging Het
Other mutations in Ttll4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01606:Ttll4 APN 1 74685893 missense probably damaging 1.00
IGL01743:Ttll4 APN 1 74688193 missense possibly damaging 0.63
IGL01914:Ttll4 APN 1 74679058 missense probably benign 0.01
IGL02288:Ttll4 APN 1 74679401 missense probably benign 0.05
IGL02621:Ttll4 APN 1 74687484 missense probably damaging 1.00
IGL02662:Ttll4 APN 1 74687231 unclassified probably null
IGL02890:Ttll4 APN 1 74687339 nonsense probably null
IGL02937:Ttll4 APN 1 74679503 missense possibly damaging 0.92
IGL03178:Ttll4 APN 1 74680408 missense probably damaging 0.96
IGL03412:Ttll4 APN 1 74687321 missense probably benign 0.28
1mM(1):Ttll4 UTSW 1 74689980 missense probably null 1.00
R0083:Ttll4 UTSW 1 74679769 missense probably benign 0.13
R0108:Ttll4 UTSW 1 74679769 missense probably benign 0.13
R0135:Ttll4 UTSW 1 74679928 missense possibly damaging 0.86
R0137:Ttll4 UTSW 1 74679692 missense possibly damaging 0.74
R0306:Ttll4 UTSW 1 74696757 missense probably benign 0.28
R0506:Ttll4 UTSW 1 74688618 missense probably benign 0.06
R0555:Ttll4 UTSW 1 74688280 missense probably damaging 1.00
R1617:Ttll4 UTSW 1 74679401 missense probably benign 0.05
R1649:Ttll4 UTSW 1 74697470 missense possibly damaging 0.52
R1793:Ttll4 UTSW 1 74687840 missense possibly damaging 0.91
R1898:Ttll4 UTSW 1 74697482 missense probably benign 0.01
R1952:Ttll4 UTSW 1 74687559 missense probably damaging 0.99
R1987:Ttll4 UTSW 1 74685368 missense possibly damaging 0.81
R1989:Ttll4 UTSW 1 74685368 missense possibly damaging 0.81
R2067:Ttll4 UTSW 1 74680382 missense possibly damaging 0.94
R2162:Ttll4 UTSW 1 74686391 missense probably damaging 1.00
R2185:Ttll4 UTSW 1 74679829 missense possibly damaging 0.54
R2875:Ttll4 UTSW 1 74686438 unclassified probably null
R2876:Ttll4 UTSW 1 74686438 unclassified probably null
R2895:Ttll4 UTSW 1 74685358 missense possibly damaging 0.92
R2896:Ttll4 UTSW 1 74685358 missense possibly damaging 0.92
R3157:Ttll4 UTSW 1 74697611 missense possibly damaging 0.81
R3832:Ttll4 UTSW 1 74686391 missense probably damaging 1.00
R4707:Ttll4 UTSW 1 74679007 missense possibly damaging 0.62
R4784:Ttll4 UTSW 1 74679007 missense possibly damaging 0.62
R4785:Ttll4 UTSW 1 74679007 missense possibly damaging 0.62
R5176:Ttll4 UTSW 1 74679286 missense probably damaging 0.99
R5202:Ttll4 UTSW 1 74687852 critical splice donor site probably null
R5264:Ttll4 UTSW 1 74686376 missense possibly damaging 0.92
R5452:Ttll4 UTSW 1 74679321 missense probably benign 0.06
R5992:Ttll4 UTSW 1 74685391 missense probably damaging 1.00
R6111:Ttll4 UTSW 1 74697539 missense possibly damaging 0.95
R6722:Ttll4 UTSW 1 74681789 missense possibly damaging 0.95
R6776:Ttll4 UTSW 1 74681353 missense probably damaging 1.00
R6815:Ttll4 UTSW 1 74679349 missense possibly damaging 0.89
R6836:Ttll4 UTSW 1 74689413 missense probably damaging 0.98
R6963:Ttll4 UTSW 1 74681816 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTGTATACATCATCAGGTGTCG -3'
(R):5'- TAACTATGGCCTCCTGTGGG -3'

Sequencing Primer
(F):5'- ATCAGGTGTCGTTTGTAGTCCCAC -3'
(R):5'- GACAGGCATATCACCTTTGAGCTTG -3'
Posted On2016-07-06