Incidental Mutation 'R6446:Pld3'
ID519189
Institutional Source Beutler Lab
Gene Symbol Pld3
Ensembl Gene ENSMUSG00000003363
Gene Namephospholipase D family, member 3
SynonymsSam-9
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6446 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location27532000-27553218 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 27537731 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 241 (D241G)
Ref Sequence ENSEMBL: ENSMUSP00000112942 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117095] [ENSMUST00000117611] [ENSMUST00000127240] [ENSMUST00000131106] [ENSMUST00000150964]
Predicted Effect probably damaging
Transcript: ENSMUST00000117095
AA Change: D241G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113820
Gene: ENSMUSG00000003363
AA Change: D241G

DomainStartEndE-ValueType
low complexity region 25 36 N/A INTRINSIC
transmembrane domain 38 60 N/A INTRINSIC
PLDc 194 221 9.25e-10 SMART
Pfam:PLDc_3 224 401 1.6e-43 PFAM
PLDc 409 435 1.19e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000117611
AA Change: D241G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112942
Gene: ENSMUSG00000003363
AA Change: D241G

DomainStartEndE-ValueType
low complexity region 25 36 N/A INTRINSIC
transmembrane domain 38 60 N/A INTRINSIC
PLDc 194 221 9.25e-10 SMART
low complexity region 285 297 N/A INTRINSIC
PLDc 409 435 1.19e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127240
SMART Domains Protein: ENSMUSP00000115891
Gene: ENSMUSG00000003363

DomainStartEndE-ValueType
low complexity region 25 36 N/A INTRINSIC
transmembrane domain 38 60 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131106
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142981
Predicted Effect probably benign
Transcript: ENSMUST00000150964
SMART Domains Protein: ENSMUSP00000122897
Gene: ENSMUSG00000003363

DomainStartEndE-ValueType
low complexity region 25 36 N/A INTRINSIC
transmembrane domain 38 60 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155287
Meta Mutation Damage Score 0.464 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.9%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the phospholipase D (PLD) family of enzymes that catalyze the hydrolysis of membrane phospholipids. The encoded protein is a single-pass type II membrane protein and contains two PLD phosphodiesterase domains. This protein influences processing of amyloid-beta precursor protein. Mutations in this gene are associated with Alzheimer disease risk. Alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Apr 2014]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp13a3 A G 16: 30,361,869 L114P probably benign Het
Blm GCCTCCTCCTCCTCCTCCTCCTCCTCCTCC GCCTCCTCCTCCTCCTCCTCCTCCTCC 7: 80,512,904 probably benign Het
Catsperg1 T C 7: 29,206,567 I196V probably benign Het
Cbx2 T A 11: 119,027,926 S106T probably benign Het
Ccar2 T A 14: 70,143,069 E354V probably benign Het
Ccr1 A G 9: 123,964,106 I129T probably damaging Het
Cdkl2 T A 5: 92,033,217 I188F probably damaging Het
Cep350 T C 1: 155,862,154 N2648D probably benign Het
Chtf18 A G 17: 25,721,244 S658P probably benign Het
Csnka2ip G A 16: 64,479,381 Q207* probably null Het
Dennd5a A G 7: 109,894,666 L1253P probably damaging Het
Dennd6a T A 14: 26,629,534 I374K probably damaging Het
Dut T C 2: 125,251,019 probably null Het
Gcm1 T C 9: 78,059,783 Y95H probably benign Het
Gm4951 A G 18: 60,245,768 D125G probably damaging Het
Grid2 A T 6: 64,345,593 I526F probably damaging Het
Hectd4 T A 5: 121,334,375 Y2725N possibly damaging Het
Helq A T 5: 100,768,384 N907K possibly damaging Het
Hpse G A 5: 100,695,569 Q246* probably null Het
Kcnj15 C T 16: 95,296,259 H247Y probably benign Het
Kif27 C A 13: 58,345,716 V138F probably damaging Het
Map7 T G 10: 20,278,233 D698E unknown Het
Mtmr11 A T 3: 96,171,188 S687C probably benign Het
Ncbp2 CGTCTGGATG CG 16: 31,956,343 probably null Het
Nup210l G A 3: 90,172,068 G953E probably damaging Het
Olfr297 T A 7: 86,527,102 I115N possibly damaging Het
Piezo2 G T 18: 63,086,607 P792T probably damaging Het
Prss35 G T 9: 86,755,653 V159F probably damaging Het
Rimbp3 A T 16: 17,212,929 M1406L probably benign Het
Serpina3g T C 12: 104,239,082 F27L probably damaging Het
Setd1b G A 5: 123,161,799 probably benign Het
Sh3glb1 T C 3: 144,705,605 K13E probably damaging Het
Slc29a1 A T 17: 45,589,245 I217N possibly damaging Het
Spag17 A T 3: 100,103,132 T1981S probably benign Het
Svil A C 18: 5,057,323 E590D probably benign Het
Synm A G 7: 67,734,966 S541P probably damaging Het
Vmn2r108 A T 17: 20,472,347 Y82* probably null Het
Other mutations in Pld3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01474:Pld3 APN 7 27532619 missense probably damaging 1.00
R0624:Pld3 UTSW 7 27539575 missense possibly damaging 0.94
R1384:Pld3 UTSW 7 27537657 missense probably benign 0.00
R1845:Pld3 UTSW 7 27539452 missense probably benign 0.01
R2235:Pld3 UTSW 7 27541107 missense probably benign 0.00
R3106:Pld3 UTSW 7 27535787 critical splice donor site probably null
R5141:Pld3 UTSW 7 27533795 missense probably damaging 1.00
R5486:Pld3 UTSW 7 27533731 missense probably damaging 0.99
R5518:Pld3 UTSW 7 27532371 missense probably damaging 1.00
R5868:Pld3 UTSW 7 27537668 missense probably benign 0.00
R6591:Pld3 UTSW 7 27532316 missense probably benign 0.00
R6691:Pld3 UTSW 7 27532316 missense probably benign 0.00
R6823:Pld3 UTSW 7 27535897 missense probably damaging 1.00
R7162:Pld3 UTSW 7 27532474 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGTATGGCCAAAAGCGACAG -3'
(R):5'- AGTTCTAGGATGTAAGCTCTTCAGAG -3'

Sequencing Primer
(F):5'- AGCGTGAGGCCCCATCTTC -3'
(R):5'- ATGTAAGCTCTTCAGAGTGGAG -3'
Posted On2018-05-24