Incidental Mutation 'R3623:Upp2'
ID268697
Institutional Source Beutler Lab
Gene Symbol Upp2
Ensembl Gene ENSMUSG00000026839
Gene Nameuridine phosphorylase 2
SynonymsUDRPASE2, UP2, UPASE2, 1700124F02Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R3623 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location58567298-58792971 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 58790116 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 300 (R300Q)
Ref Sequence ENSEMBL: ENSMUSP00000099816 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059102] [ENSMUST00000071543] [ENSMUST00000102755] [ENSMUST00000229923] [ENSMUST00000230627]
Predicted Effect possibly damaging
Transcript: ENSMUST00000059102
AA Change: R318Q

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000060437
Gene: ENSMUSG00000026839
AA Change: R318Q

DomainStartEndE-ValueType
Pfam:PNP_UDP_1 78 328 6.4e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000071543
SMART Domains Protein: ENSMUSP00000071474
Gene: ENSMUSG00000026839

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Pfam:PNP_UDP_1 98 316 7.1e-26 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000102755
AA Change: R300Q

PolyPhen 2 Score 0.832 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000099816
Gene: ENSMUSG00000026839
AA Change: R300Q

DomainStartEndE-ValueType
Pfam:PNP_UDP_1 60 310 4.2e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128864
Predicted Effect probably benign
Transcript: ENSMUST00000229923
Predicted Effect probably benign
Transcript: ENSMUST00000230627
AA Change: R266Q

PolyPhen 2 Score 0.389 (Sensitivity: 0.90; Specificity: 0.89)
Meta Mutation Damage Score 0.238 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (69/69)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy1 A G 11: 7,130,348 T364A probably benign Het
Adpgk G A 9: 59,313,753 V281I probably benign Het
Akap9 C A 5: 3,976,235 Q1297K possibly damaging Het
Ankrd13d T C 19: 4,281,940 E110G probably damaging Het
Ankrd53 A G 6: 83,763,262 E104G possibly damaging Het
Bscl2 T A 19: 8,841,150 C40S probably benign Het
Btaf1 A G 19: 36,981,086 T668A probably benign Het
Camk2g G A 14: 20,755,707 probably benign Het
Cd109 A T 9: 78,667,357 D541V probably damaging Het
Cep135 G A 5: 76,624,739 G657D probably benign Het
Coch A G 12: 51,602,826 I307V probably benign Het
D17H6S53E A G 17: 35,127,536 E141G probably benign Het
Ddias T C 7: 92,859,592 T372A probably benign Het
Dffb T C 4: 153,965,519 T296A probably damaging Het
Dock8 A G 19: 25,079,877 Q216R probably benign Het
Ep400 T C 5: 110,719,236 Y1014C unknown Het
Ephx1 A G 1: 180,989,933 I391T probably benign Het
Fam208b T C 13: 3,595,556 T98A probably benign Het
Fcgbp A G 7: 28,101,276 Y1249C probably damaging Het
Gm38100 T C 1: 175,920,631 C88R possibly damaging Het
Gm5592 T C 7: 41,157,628 probably benign Het
Gm7964 A G 7: 83,756,421 N149S probably benign Het
Greb1l T A 18: 10,542,380 I1325N probably damaging Het
H2-T3 T C 17: 36,190,065 T20A possibly damaging Het
Htr1d T C 4: 136,443,504 I348T probably damaging Het
Hyal4 A T 6: 24,765,738 S364C probably damaging Het
Igkv1-133 A T 6: 67,724,960 Q16L probably benign Het
Irs2 C T 8: 11,007,643 G263D probably damaging Het
Itga10 C T 3: 96,651,738 probably benign Het
Kmt2a A G 9: 44,848,966 Y529H probably damaging Het
Mdfic T A 6: 15,770,320 N108K probably damaging Het
Met A T 6: 17,549,086 D979V probably damaging Het
Mettl21e T A 1: 44,206,697 I130F probably damaging Het
Mlh3 C T 12: 85,268,395 C339Y probably damaging Het
Mog T C 17: 37,012,446 H200R possibly damaging Het
Msrb3 C T 10: 120,784,198 R72H probably damaging Het
Mtmr11 A G 3: 96,165,266 H324R probably damaging Het
Myh7 T C 14: 54,973,381 E1693G probably damaging Het
Nadk2 T A 15: 9,084,223 W139R probably damaging Het
Ndufa9 A T 6: 126,844,399 M76K possibly damaging Het
Nr1i2 A G 16: 38,265,907 probably benign Het
Nsd3 A G 8: 25,662,819 T392A probably damaging Het
Olfr305 A G 7: 86,364,100 F79S probably benign Het
Olfr653 T C 7: 104,579,942 S99P probably damaging Het
P2ry2 A T 7: 100,998,499 S200T probably benign Het
Pcnt T A 10: 76,433,750 E228V probably benign Het
Phka2 T A X: 160,544,295 Y334* probably null Het
Pkhd1l1 A T 15: 44,526,869 K1460N probably damaging Het
Rpl7a-ps3 G A 15: 36,308,283 noncoding transcript Het
Rspry1 A G 8: 94,649,777 D309G probably damaging Het
Scap A G 9: 110,380,203 Y648C probably damaging Het
Sgcz T C 8: 37,953,047 E17G probably damaging Het
Slc17a5 A T 9: 78,538,274 V433D probably damaging Het
Smad9 C T 3: 54,789,284 R257W probably damaging Het
Srcap T C 7: 127,542,147 S1639P probably damaging Het
Strn3 T C 12: 51,661,216 Y132C possibly damaging Het
Tas2r110 A T 6: 132,868,470 M155L probably benign Het
Thbd A G 2: 148,406,973 V325A probably damaging Het
Trpd52l3 T A 19: 30,003,933 C29* probably null Het
Trpm1 A G 7: 64,244,853 Y951C probably damaging Het
Ube3a T A 7: 59,272,112 N77K probably damaging Het
Usp35 T C 7: 97,312,620 H533R probably damaging Het
Veph1 C T 3: 66,215,437 V224I probably benign Het
Vmn1r30 A T 6: 58,435,452 F132I probably benign Het
Vmn2r24 A G 6: 123,816,038 R775G probably damaging Het
Vps13c T A 9: 67,975,907 probably null Het
Vps37c T A 19: 10,706,205 probably null Het
Zap70 C T 1: 36,779,135 T301I probably benign Het
Zfp341 A G 2: 154,624,881 K57E probably damaging Het
Zfp60 T A 7: 27,749,328 F474I probably benign Het
Zfp786 T C 6: 47,821,423 N194D probably benign Het
Other mutations in Upp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00863:Upp2 APN 2 58790064 missense probably benign 0.43
IGL01716:Upp2 APN 2 58790046 missense probably damaging 0.99
IGL02069:Upp2 APN 2 58771417 splice site probably benign
IGL02349:Upp2 APN 2 58777886 missense probably benign 0.03
IGL03072:Upp2 APN 2 58755423 critical splice donor site probably null
R0815:Upp2 UTSW 2 58771556 missense probably benign 0.00
R1164:Upp2 UTSW 2 58763704 missense probably damaging 1.00
R1400:Upp2 UTSW 2 58790106 missense probably damaging 1.00
R1553:Upp2 UTSW 2 58790140 missense probably damaging 1.00
R1581:Upp2 UTSW 2 58774165 missense possibly damaging 0.93
R1674:Upp2 UTSW 2 58790064 missense probably benign 0.43
R1702:Upp2 UTSW 2 58771550 missense possibly damaging 0.86
R1902:Upp2 UTSW 2 58771452 missense probably damaging 1.00
R2351:Upp2 UTSW 2 58763662 splice site probably null
R3011:Upp2 UTSW 2 58790095 missense probably damaging 0.97
R3622:Upp2 UTSW 2 58790116 missense possibly damaging 0.83
R3731:Upp2 UTSW 2 58755367 missense probably benign 0.02
R4257:Upp2 UTSW 2 58780094 missense probably damaging 1.00
R4296:Upp2 UTSW 2 58778009 missense probably damaging 1.00
R4768:Upp2 UTSW 2 58777895 missense probably damaging 0.99
R5116:Upp2 UTSW 2 58771542 missense probably damaging 1.00
R5638:Upp2 UTSW 2 58790095 missense probably damaging 0.97
R7100:Upp2 UTSW 2 58791805 missense probably benign
R7421:Upp2 UTSW 2 58771574 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- CCGATTGCGTCTACATTACAGGG -3'
(R):5'- ACTCGTTCCAAAATGGGATTTG -3'

Sequencing Primer
(F):5'- AATGTACATGTTGAGAATGTTAGTGC -3'
(R):5'- CCAAAATGGGATTTGAATTTCGC -3'
Posted On2015-02-19