Incidental Mutation 'R3789:Fsip2'
ID272421
Institutional Source Beutler Lab
Gene Symbol Fsip2
Ensembl Gene ENSMUSG00000075249
Gene Namefibrous sheath-interacting protein 2
SynonymsOTTMUSG00000013335
MMRRC Submission 041604-MU
Accession Numbers

Genbank: XM_913669; MGI: 2664111

Is this an essential gene? Possibly non essential (E-score: 0.264) question?
Stock #R3789 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location82943634-83008937 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 82982714 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 640 (S640P)
Gene Model predicted gene model for transcript(s): [ENSMUST00000143764]
Predicted Effect probably damaging
Transcript: ENSMUST00000132967
AA Change: S640P

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000122350
Gene: ENSMUSG00000075249
AA Change: S640P

DomainStartEndE-ValueType
low complexity region 22 38 N/A INTRINSIC
low complexity region 79 90 N/A INTRINSIC
low complexity region 381 392 N/A INTRINSIC
low complexity region 411 430 N/A INTRINSIC
low complexity region 735 746 N/A INTRINSIC
low complexity region 953 962 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000143764
AA Change: S3126P

PolyPhen 2 Score 0.720 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000120314
Gene: ENSMUSG00000075249
AA Change: S3126P

DomainStartEndE-ValueType
coiled coil region 271 297 N/A INTRINSIC
low complexity region 544 561 N/A INTRINSIC
low complexity region 586 597 N/A INTRINSIC
low complexity region 882 895 N/A INTRINSIC
low complexity region 925 939 N/A INTRINSIC
low complexity region 1115 1120 N/A INTRINSIC
low complexity region 1531 1545 N/A INTRINSIC
low complexity region 2044 2057 N/A INTRINSIC
low complexity region 2507 2523 N/A INTRINSIC
low complexity region 2564 2575 N/A INTRINSIC
low complexity region 2866 2877 N/A INTRINSIC
low complexity region 2896 2915 N/A INTRINSIC
low complexity region 3220 3231 N/A INTRINSIC
low complexity region 3438 3447 N/A INTRINSIC
Pfam:FSIP2 4045 4408 3.5e-42 PFAM
Pfam:FSIP2 4375 4613 7.7e-26 PFAM
Pfam:FSIP2 4622 4932 4.3e-17 PFAM
Pfam:FSIP2 4903 5454 7e-27 PFAM
low complexity region 5507 5522 N/A INTRINSIC
low complexity region 5769 5780 N/A INTRINSIC
low complexity region 5834 5846 N/A INTRINSIC
low complexity region 5851 5867 N/A INTRINSIC
Pfam:FSIP2 5998 6867 N/A PFAM
low complexity region 6977 6990 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein associated with the sperm fibrous sheath. Genes encoding most of the fibrous-sheath associated proteins genes are transcribed only during the postmeiotic period of spermatogenesis. The protein encoded by this gene is specific to spermatogenic cells. Copy number variation in this gene may be associated with testicular germ cell tumors. Pseudogenes associated with this gene are reported on chromosomes 2 and X. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230104L09Rik C A 2: 148,847,958 E92* probably null Het
Abca13 T A 11: 9,510,668 I4226N probably damaging Het
Abhd16a A G 17: 35,101,587 N411S probably damaging Het
Acvrl1 C T 15: 101,137,469 T292M probably damaging Het
Adamts8 T C 9: 30,959,292 S688P probably damaging Het
Adprhl2 A T 4: 126,316,751 I312N probably damaging Het
Bclaf3 A G X: 159,566,496 H619R probably benign Het
Clca4a C A 3: 144,974,956 G20V probably damaging Het
Col12a1 C A 9: 79,639,723 V2276L possibly damaging Het
Drosha T A 15: 12,912,537 Y1080* probably null Het
Dysf G A 6: 84,186,509 probably null Het
Ebf2 T A 14: 67,239,493 probably null Het
Emc8 T C 8: 120,658,130 T195A probably benign Het
Fam60a A G 6: 148,926,119 S134P possibly damaging Het
Frs3 G A 17: 47,699,696 probably null Het
Hdhd2 G A 18: 76,955,187 probably null Het
Hivep3 T C 4: 120,098,416 S1310P probably damaging Het
Hltf C T 3: 20,069,047 P200S probably damaging Het
Lnpk A T 2: 74,522,263 S358R probably benign Het
Lrp1 T C 10: 127,571,969 D1817G possibly damaging Het
Lrpprc T C 17: 84,771,528 I253V probably benign Het
Map2 A G 1: 66,416,863 T1512A probably damaging Het
Mcm9 G A 10: 53,616,017 R403W probably damaging Het
Mms22l A G 4: 24,517,115 D222G possibly damaging Het
Mug1 G A 6: 121,884,628 V1350I probably benign Het
Olfr663 T A 7: 104,703,949 D127E probably damaging Het
Pclo A G 5: 14,680,450 probably benign Het
Plekha7 A C 7: 116,175,734 I175R probably damaging Het
Plxnb1 T A 9: 109,109,287 V1303D possibly damaging Het
Pou2f1 G C 1: 165,894,969 P349R probably damaging Het
Prmt8 A T 6: 127,711,147 I236N probably damaging Het
Rexo2 A G 9: 48,473,062 I139T probably damaging Het
Rsbn1l A C 5: 20,896,108 S811R probably benign Het
Sec24b T C 3: 130,020,627 D345G probably benign Het
Serpina1b A G 12: 103,729,272 S337P probably damaging Het
Snx33 T C 9: 56,918,560 E539G probably benign Het
Sorcs3 A G 19: 48,398,711 T212A possibly damaging Het
Spa17 T G 9: 37,611,845 K49Q possibly damaging Het
St3gal6 C T 16: 58,484,773 E109K probably benign Het
Stat4 A G 1: 52,011,796 N5D probably benign Het
Tmem232 C T 17: 65,382,525 D532N probably benign Het
Tmem232 C A 17: 65,382,633 D496Y possibly damaging Het
Tmem81 A G 1: 132,508,071 N205S probably benign Het
Tomm20l C T 12: 71,111,742 A58V possibly damaging Het
Ttn A G 2: 76,974,208 V240A probably benign Het
Vmn2r23 A T 6: 123,741,389 N567I probably damaging Het
Other mutations in Fsip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Fsip2 APN 2 82990386 missense probably benign 0.18
IGL00557:Fsip2 APN 2 82991313 missense possibly damaging 0.53
IGL01343:Fsip2 APN 2 82999819 missense possibly damaging 0.53
IGL01387:Fsip2 APN 2 82992982 missense possibly damaging 0.71
IGL01523:Fsip2 APN 2 82977519 missense probably benign
IGL01554:Fsip2 APN 2 82977278 missense possibly damaging 0.68
IGL01650:Fsip2 APN 2 82991086 missense probably benign 0.33
IGL01809:Fsip2 APN 2 82978347 missense possibly damaging 0.80
IGL01826:Fsip2 APN 2 82982639 missense probably benign 0.18
IGL01830:Fsip2 APN 2 82984929 missense probably benign
IGL01918:Fsip2 APN 2 82992138 missense possibly damaging 0.71
IGL01932:Fsip2 APN 2 82994005 missense possibly damaging 0.71
IGL01989:Fsip2 APN 2 82993867 missense probably damaging 0.99
IGL02096:Fsip2 APN 2 82991860 missense possibly damaging 0.85
IGL02153:Fsip2 APN 2 82978721 missense probably benign
IGL02155:Fsip2 APN 2 82998352 missense probably benign
IGL02219:Fsip2 APN 2 82977830 missense probably benign 0.07
IGL02248:Fsip2 APN 2 82982772 missense possibly damaging 0.73
IGL02316:Fsip2 APN 2 82978793 missense probably benign
IGL02478:Fsip2 APN 2 82984392 missense probably benign 0.00
IGL02504:Fsip2 APN 2 82978855 missense possibly damaging 0.83
IGL02572:Fsip2 APN 2 82992003 missense probably benign 0.32
IGL02625:Fsip2 APN 2 82949492 missense probably benign 0.00
IGL02665:Fsip2 APN 2 82993063 missense probably damaging 1.00
IGL02668:Fsip2 APN 2 82998318 missense probably benign 0.06
IGL02676:Fsip2 APN 2 82982157 missense possibly damaging 0.53
IGL02717:Fsip2 APN 2 82951026 splice site probably benign
IGL02805:Fsip2 APN 2 82993495 missense probably benign 0.01
IGL02943:Fsip2 APN 2 82992357 missense probably benign 0.32
IGL02965:Fsip2 APN 2 82983054 missense probably benign 0.33
IGL03001:Fsip2 APN 2 82990624 intron probably benign
IGL03076:Fsip2 APN 2 82982138 missense possibly damaging 0.96
IGL03229:Fsip2 APN 2 82978076 missense possibly damaging 0.86
IGL03353:Fsip2 APN 2 82977393 missense possibly damaging 0.85
IGL03401:Fsip2 APN 2 82990470 missense probably benign
engulf UTSW 2 82984776 missense probably damaging 0.98
envelope UTSW 2 82980741 missense probably benign 0.07
glove UTSW 2 82978394 missense possibly damaging 0.85
swaddle UTSW 2 82983428 missense possibly damaging 0.93
wrap UTSW 2 82986820 missense probably benign 0.04
wrapper UTSW 2 82990086 missense possibly damaging 0.71
D4186:Fsip2 UTSW 2 82988412 missense probably benign 0.32
FR4976:Fsip2 UTSW 2 82984362 critical splice acceptor site probably benign
FR4976:Fsip2 UTSW 2 82984365 critical splice acceptor site probably benign
PIT4382001:Fsip2 UTSW 2 82990852 missense possibly damaging 0.86
R0017:Fsip2 UTSW 2 82992072 missense probably damaging 0.98
R0017:Fsip2 UTSW 2 82992072 missense probably damaging 0.98
R0021:Fsip2 UTSW 2 82999857 splice site probably benign
R0054:Fsip2 UTSW 2 82986955 missense possibly damaging 0.85
R0054:Fsip2 UTSW 2 82976608 missense probably damaging 0.96
R0054:Fsip2 UTSW 2 82986955 missense possibly damaging 0.85
R0104:Fsip2 UTSW 2 82978973 missense possibly damaging 0.91
R0104:Fsip2 UTSW 2 82978973 missense possibly damaging 0.91
R0127:Fsip2 UTSW 2 82984925 missense probably benign 0.28
R0131:Fsip2 UTSW 2 82991121 missense probably benign
R0149:Fsip2 UTSW 2 82975505 missense possibly damaging 0.93
R0167:Fsip2 UTSW 2 82980807 missense possibly damaging 0.53
R0190:Fsip2 UTSW 2 82985177 missense possibly damaging 0.73
R0323:Fsip2 UTSW 2 82985896 missense probably benign 0.33
R0358:Fsip2 UTSW 2 82983333 missense possibly damaging 0.56
R0361:Fsip2 UTSW 2 82975505 missense possibly damaging 0.93
R0369:Fsip2 UTSW 2 82984564 missense probably benign 0.33
R0394:Fsip2 UTSW 2 82991075 missense possibly damaging 0.70
R0532:Fsip2 UTSW 2 82977785 missense probably benign 0.33
R0595:Fsip2 UTSW 2 82946952 missense probably damaging 0.99
R0613:Fsip2 UTSW 2 82993795 missense probably damaging 0.99
R0614:Fsip2 UTSW 2 82977533 missense probably benign 0.15
R0619:Fsip2 UTSW 2 82944140 missense probably damaging 1.00
R0626:Fsip2 UTSW 2 82988958 missense probably benign 0.06
R0644:Fsip2 UTSW 2 82976897 missense probably benign 0.02
R0661:Fsip2 UTSW 2 82986169 missense possibly damaging 0.92
R0680:Fsip2 UTSW 2 82991359 missense possibly damaging 0.73
R0688:Fsip2 UTSW 2 82982339 missense probably benign 0.18
R0881:Fsip2 UTSW 2 82986273 missense possibly damaging 0.52
R0919:Fsip2 UTSW 2 82985484 missense possibly damaging 0.53
R0973:Fsip2 UTSW 2 82977092 missense probably benign 0.05
R0973:Fsip2 UTSW 2 82977092 missense probably benign 0.05
R0974:Fsip2 UTSW 2 82977092 missense probably benign 0.05
R0976:Fsip2 UTSW 2 82998031 missense possibly damaging 0.92
R1025:Fsip2 UTSW 2 82989436 nonsense probably null
R1026:Fsip2 UTSW 2 82988461 missense possibly damaging 0.52
R1140:Fsip2 UTSW 2 82975034 missense probably damaging 0.99
R1170:Fsip2 UTSW 2 82991500 missense possibly damaging 0.72
R1180:Fsip2 UTSW 2 82975226 missense probably damaging 0.99
R1188:Fsip2 UTSW 2 82975017 missense possibly damaging 0.96
R1226:Fsip2 UTSW 2 82981011 missense probably damaging 0.96
R1248:Fsip2 UTSW 2 82989763 missense possibly damaging 0.93
R1273:Fsip2 UTSW 2 82989408 missense possibly damaging 0.92
R1323:Fsip2 UTSW 2 82985752 missense probably damaging 1.00
R1323:Fsip2 UTSW 2 82985752 missense probably damaging 1.00
R1356:Fsip2 UTSW 2 82989745 missense probably benign 0.38
R1413:Fsip2 UTSW 2 82988418 missense possibly damaging 0.93
R1430:Fsip2 UTSW 2 82998063 missense possibly damaging 0.71
R1475:Fsip2 UTSW 2 82987195 missense probably damaging 0.99
R1489:Fsip2 UTSW 2 82979811 missense probably benign
R1520:Fsip2 UTSW 2 82980714 missense possibly damaging 0.96
R1543:Fsip2 UTSW 2 82981587 missense possibly damaging 0.91
R1581:Fsip2 UTSW 2 82986282 missense probably damaging 0.98
R1590:Fsip2 UTSW 2 82982787 missense probably benign 0.26
R1646:Fsip2 UTSW 2 82978517 missense probably benign 0.07
R1678:Fsip2 UTSW 2 82986345 missense probably benign
R1700:Fsip2 UTSW 2 82991737 missense probably benign 0.33
R1717:Fsip2 UTSW 2 82974945 missense possibly damaging 0.68
R1741:Fsip2 UTSW 2 82989912 missense probably benign 0.32
R1760:Fsip2 UTSW 2 82984896 missense probably benign 0.07
R1760:Fsip2 UTSW 2 82987711 missense possibly damaging 0.71
R1760:Fsip2 UTSW 2 82999841 missense possibly damaging 0.85
R1789:Fsip2 UTSW 2 82977562 missense probably benign 0.00
R1850:Fsip2 UTSW 2 82984589 missense possibly damaging 0.72
R1854:Fsip2 UTSW 2 82993257 missense possibly damaging 0.84
R1888:Fsip2 UTSW 2 82944160 missense probably benign 0.04
R1888:Fsip2 UTSW 2 82944160 missense probably benign 0.04
R1905:Fsip2 UTSW 2 82983428 missense possibly damaging 0.93
R1907:Fsip2 UTSW 2 82983428 missense possibly damaging 0.93
R1920:Fsip2 UTSW 2 82986820 missense probably benign 0.04
R1921:Fsip2 UTSW 2 82980783 nonsense probably null
R1921:Fsip2 UTSW 2 82986820 missense probably benign 0.04
R1931:Fsip2 UTSW 2 82986733 missense probably damaging 0.99
R1934:Fsip2 UTSW 2 82980558 missense possibly damaging 0.91
R1959:Fsip2 UTSW 2 82991550 missense probably benign
R1965:Fsip2 UTSW 2 82992780 missense possibly damaging 0.86
R1966:Fsip2 UTSW 2 82992780 missense possibly damaging 0.86
R1983:Fsip2 UTSW 2 82979831 missense probably benign
R1988:Fsip2 UTSW 2 82976517 missense possibly damaging 0.56
R2016:Fsip2 UTSW 2 82982732 missense possibly damaging 0.53
R2017:Fsip2 UTSW 2 82982732 missense possibly damaging 0.53
R2026:Fsip2 UTSW 2 82989444 missense possibly damaging 0.71
R2034:Fsip2 UTSW 2 82989494 missense probably benign 0.43
R2037:Fsip2 UTSW 2 82978512 missense probably damaging 0.99
R2070:Fsip2 UTSW 2 82976355 missense probably damaging 0.98
R2072:Fsip2 UTSW 2 83008815 missense possibly damaging 0.53
R2075:Fsip2 UTSW 2 82988579 missense possibly damaging 0.85
R2143:Fsip2 UTSW 2 82990271 missense possibly damaging 0.93
R2207:Fsip2 UTSW 2 82977479 missense probably benign 0.02
R2256:Fsip2 UTSW 2 82962751 missense probably benign 0.07
R2315:Fsip2 UTSW 2 82975093 missense probably benign
R2344:Fsip2 UTSW 2 82989913 missense possibly damaging 0.71
R2377:Fsip2 UTSW 2 82976249 missense probably benign 0.29
R2403:Fsip2 UTSW 2 82980720 missense possibly damaging 0.53
R2441:Fsip2 UTSW 2 82985341 missense possibly damaging 0.53
R2504:Fsip2 UTSW 2 82979610 missense possibly damaging 0.86
R2510:Fsip2 UTSW 2 82986438 missense probably benign
R2511:Fsip2 UTSW 2 82951657 missense probably damaging 1.00
R2511:Fsip2 UTSW 2 82986438 missense probably benign
R2512:Fsip2 UTSW 2 82978167 missense probably benign 0.04
R2568:Fsip2 UTSW 2 82990431 missense probably benign 0.14
R2656:Fsip2 UTSW 2 82979045 missense possibly damaging 0.83
R2883:Fsip2 UTSW 2 82991524 missense possibly damaging 0.86
R3417:Fsip2 UTSW 2 82986510 missense possibly damaging 0.51
R3431:Fsip2 UTSW 2 82992010 missense possibly damaging 0.85
R3441:Fsip2 UTSW 2 82986727 missense probably benign 0.00
R3605:Fsip2 UTSW 2 82984909 missense probably benign 0.28
R3620:Fsip2 UTSW 2 82980258 missense probably benign 0.00
R3621:Fsip2 UTSW 2 82980258 missense probably benign 0.00
R3726:Fsip2 UTSW 2 82988967 missense possibly damaging 0.84
R3755:Fsip2 UTSW 2 82978217 missense probably benign 0.26
R3836:Fsip2 UTSW 2 82950946 missense probably damaging 1.00
R3844:Fsip2 UTSW 2 82989606 missense possibly damaging 0.52
R3846:Fsip2 UTSW 2 82986415 missense possibly damaging 0.52
R3861:Fsip2 UTSW 2 82984776 missense probably damaging 0.98
R3981:Fsip2 UTSW 2 82958662 missense probably benign 0.08
R4014:Fsip2 UTSW 2 82983518 missense probably benign
R4042:Fsip2 UTSW 2 82983552 missense probably benign 0.02
R4075:Fsip2 UTSW 2 82982901 missense probably benign 0.26
R4154:Fsip2 UTSW 2 82987069 missense possibly damaging 0.71
R4210:Fsip2 UTSW 2 82975149 missense probably damaging 0.99
R4211:Fsip2 UTSW 2 82975149 missense probably damaging 0.99
R4327:Fsip2 UTSW 2 82987059 missense probably benign 0.25
R4332:Fsip2 UTSW 2 82977857 missense probably benign 0.00
R4440:Fsip2 UTSW 2 82991206 missense possibly damaging 0.85
R4454:Fsip2 UTSW 2 82990776 missense possibly damaging 0.70
R4455:Fsip2 UTSW 2 82990776 missense possibly damaging 0.70
R4457:Fsip2 UTSW 2 82990776 missense possibly damaging 0.70
R4458:Fsip2 UTSW 2 82990776 missense possibly damaging 0.70
R4540:Fsip2 UTSW 2 82951665 missense probably benign
R4549:Fsip2 UTSW 2 82989628 missense probably damaging 0.99
R4558:Fsip2 UTSW 2 82984953 missense possibly damaging 0.73
R4573:Fsip2 UTSW 2 82986166 missense possibly damaging 0.71
R4583:Fsip2 UTSW 2 82978673 missense probably benign 0.33
R4618:Fsip2 UTSW 2 82987759 missense probably benign
R4700:Fsip2 UTSW 2 82987029 missense probably benign 0.32
R4716:Fsip2 UTSW 2 82974859 missense probably damaging 0.96
R4739:Fsip2 UTSW 2 82975353 missense possibly damaging 0.92
R4749:Fsip2 UTSW 2 82989285 missense probably benign 0.06
R4791:Fsip2 UTSW 2 82982108 missense possibly damaging 0.53
R4793:Fsip2 UTSW 2 82987700 nonsense probably null
R4819:Fsip2 UTSW 2 82988442 missense probably benign 0.06
R4832:Fsip2 UTSW 2 82990171 missense possibly damaging 0.92
R4840:Fsip2 UTSW 2 82949395 missense probably benign 0.01
R4840:Fsip2 UTSW 2 82985471 missense probably benign 0.26
R4865:Fsip2 UTSW 2 82990951 missense possibly damaging 0.86
R4876:Fsip2 UTSW 2 82974858 missense possibly damaging 0.91
R4885:Fsip2 UTSW 2 82988094 missense probably benign 0.02
R4911:Fsip2 UTSW 2 82981493 missense possibly damaging 0.85
R4918:Fsip2 UTSW 2 82993770 missense possibly damaging 0.51
R4936:Fsip2 UTSW 2 82985040 missense probably benign 0.18
R4950:Fsip2 UTSW 2 82946932 missense probably damaging 0.97
R4950:Fsip2 UTSW 2 82977414 missense probably benign 0.03
R4959:Fsip2 UTSW 2 82984825 missense probably benign 0.00
R4971:Fsip2 UTSW 2 82985878 missense probably benign 0.38
R4973:Fsip2 UTSW 2 82984825 missense probably benign 0.00
R4976:Fsip2 UTSW 2 82988191 missense probably damaging 0.99
R5022:Fsip2 UTSW 2 82979429 missense probably benign 0.33
R5027:Fsip2 UTSW 2 82989133 missense possibly damaging 0.71
R5030:Fsip2 UTSW 2 82988492 missense possibly damaging 0.85
R5048:Fsip2 UTSW 2 82993150 missense probably damaging 0.97
R5096:Fsip2 UTSW 2 82991116 missense probably benign 0.00
R5097:Fsip2 UTSW 2 82991985 missense probably benign
R5119:Fsip2 UTSW 2 82988191 missense probably damaging 0.99
R5138:Fsip2 UTSW 2 82981424 missense probably benign 0.12
R5152:Fsip2 UTSW 2 82978572 missense probably benign 0.43
R5174:Fsip2 UTSW 2 82980741 missense probably benign 0.07
R5193:Fsip2 UTSW 2 82982994 missense possibly damaging 0.53
R5245:Fsip2 UTSW 2 82993161 missense probably benign 0.02
R5282:Fsip2 UTSW 2 82978581 missense possibly damaging 0.61
R5323:Fsip2 UTSW 2 82988145 missense possibly damaging 0.71
R5326:Fsip2 UTSW 2 82981863 missense possibly damaging 0.84
R5378:Fsip2 UTSW 2 82989841 missense possibly damaging 0.71
R5380:Fsip2 UTSW 2 82975398 missense possibly damaging 0.91
R5396:Fsip2 UTSW 2 82990918 missense probably benign 0.00
R5422:Fsip2 UTSW 2 82982228 missense probably benign 0.00
R5481:Fsip2 UTSW 2 82979886 missense probably benign 0.26
R5482:Fsip2 UTSW 2 82985310 missense possibly damaging 0.80
R5513:Fsip2 UTSW 2 82950908 missense probably damaging 1.00
R5513:Fsip2 UTSW 2 82950912 missense probably benign 0.07
R5513:Fsip2 UTSW 2 82985198 missense possibly damaging 0.72
R5536:Fsip2 UTSW 2 82987059 missense probably benign 0.25
R5542:Fsip2 UTSW 2 82981863 missense possibly damaging 0.84
R5553:Fsip2 UTSW 2 82962746 missense probably benign
R5568:Fsip2 UTSW 2 82986564 missense probably benign 0.25
R5581:Fsip2 UTSW 2 82998128 missense possibly damaging 0.84
R5664:Fsip2 UTSW 2 82988095 missense probably benign 0.05
R5672:Fsip2 UTSW 2 82987494 nonsense probably null
R5712:Fsip2 UTSW 2 83008848 missense possibly damaging 0.73
R5762:Fsip2 UTSW 2 82977916 missense probably benign 0.33
R5772:Fsip2 UTSW 2 82984740 missense probably benign
R5881:Fsip2 UTSW 2 82984441 missense possibly damaging 0.72
R5919:Fsip2 UTSW 2 82992609 missense possibly damaging 0.71
R5920:Fsip2 UTSW 2 82988508 nonsense probably null
R5934:Fsip2 UTSW 2 82986748 missense possibly damaging 0.86
R5938:Fsip2 UTSW 2 82977491 missense probably benign 0.00
R5974:Fsip2 UTSW 2 82963313 missense possibly damaging 0.68
R5991:Fsip2 UTSW 2 82990468 missense probably benign 0.28
R6019:Fsip2 UTSW 2 82987939 missense possibly damaging 0.52
R6020:Fsip2 UTSW 2 82992127 missense probably damaging 0.99
R6056:Fsip2 UTSW 2 82985673 missense probably benign 0.01
R6057:Fsip2 UTSW 2 82979433 missense probably damaging 0.99
R6139:Fsip2 UTSW 2 82991044 missense possibly damaging 0.85
R6145:Fsip2 UTSW 2 82993768 missense possibly damaging 0.71
R6160:Fsip2 UTSW 2 82987945 nonsense probably null
R6161:Fsip2 UTSW 2 82987257 missense possibly damaging 0.80
R6166:Fsip2 UTSW 2 82980727 missense probably benign 0.00
R6187:Fsip2 UTSW 2 82982454 missense probably benign 0.33
R6196:Fsip2 UTSW 2 82989883 missense possibly damaging 0.71
R6217:Fsip2 UTSW 2 82988418 missense possibly damaging 0.93
R6276:Fsip2 UTSW 2 82980441 missense possibly damaging 0.91
R6278:Fsip2 UTSW 2 82988898 missense probably benign 0.16
R6349:Fsip2 UTSW 2 82993072 missense probably benign 0.05
R6351:Fsip2 UTSW 2 82992684 missense possibly damaging 0.51
R6401:Fsip2 UTSW 2 82990086 missense possibly damaging 0.71
R6404:Fsip2 UTSW 2 82990086 missense possibly damaging 0.71
R6405:Fsip2 UTSW 2 82990086 missense possibly damaging 0.71
R6437:Fsip2 UTSW 2 82983492 missense possibly damaging 0.73
R6478:Fsip2 UTSW 2 82990086 missense possibly damaging 0.71
R6479:Fsip2 UTSW 2 82990086 missense possibly damaging 0.71
R6480:Fsip2 UTSW 2 82990086 missense possibly damaging 0.71
R6481:Fsip2 UTSW 2 82990086 missense possibly damaging 0.71
R6521:Fsip2 UTSW 2 82990086 missense possibly damaging 0.71
R6529:Fsip2 UTSW 2 82982313 missense probably benign
R6621:Fsip2 UTSW 2 82989814 missense possibly damaging 0.93
R6639:Fsip2 UTSW 2 82983227 missense possibly damaging 0.85
R6649:Fsip2 UTSW 2 82967817 missense possibly damaging 0.83
R6714:Fsip2 UTSW 2 82979534 missense probably benign 0.01
R6714:Fsip2 UTSW 2 82990086 missense possibly damaging 0.71
R6749:Fsip2 UTSW 2 82978394 missense possibly damaging 0.85
R6765:Fsip2 UTSW 2 82986432 missense probably benign
R6790:Fsip2 UTSW 2 82990939 missense possibly damaging 0.53
R6793:Fsip2 UTSW 2 82989494 missense probably benign 0.43
R6795:Fsip2 UTSW 2 82980959 missense probably benign 0.08
R6818:Fsip2 UTSW 2 82985200 missense probably benign 0.04
R6844:Fsip2 UTSW 2 82983625 missense possibly damaging 0.72
R6848:Fsip2 UTSW 2 82982787 missense probably benign 0.26
R6945:Fsip2 UTSW 2 82992840 missense probably benign 0.16
R6950:Fsip2 UTSW 2 82985988 missense probably benign 0.03
R6951:Fsip2 UTSW 2 82981949 missense possibly damaging 0.68
R6974:Fsip2 UTSW 2 82978717 missense probably damaging 0.96
R6987:Fsip2 UTSW 2 82948286 nonsense probably null
R6989:Fsip2 UTSW 2 82976954 missense probably benign 0.00
R7001:Fsip2 UTSW 2 82986925 missense probably damaging 1.00
R7002:Fsip2 UTSW 2 82989343 missense possibly damaging 0.86
R7016:Fsip2 UTSW 2 82990635 missense probably benign 0.25
R7066:Fsip2 UTSW 2 82990891 missense possibly damaging 0.86
R7067:Fsip2 UTSW 2 82980734 missense possibly damaging 0.85
R7077:Fsip2 UTSW 2 82983152 missense probably benign 0.18
R7099:Fsip2 UTSW 2 82987624 missense probably benign
R7126:Fsip2 UTSW 2 82983141 missense possibly damaging 0.53
X0018:Fsip2 UTSW 2 82982507 nonsense probably null
X0020:Fsip2 UTSW 2 82951020 missense probably damaging 1.00
X0025:Fsip2 UTSW 2 82954946 missense possibly damaging 0.70
X0027:Fsip2 UTSW 2 82976778 missense probably benign 0.35
X0066:Fsip2 UTSW 2 82987463 missense possibly damaging 0.51
Z1088:Fsip2 UTSW 2 82975448 missense probably damaging 0.96
Z1088:Fsip2 UTSW 2 82987653 missense possibly damaging 0.86
Z1088:Fsip2 UTSW 2 82988634 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- TTTGGTGATGAGTCCAAGCCAG -3'
(R):5'- ATGCCTGACACACTCCCTTG -3'

Sequencing Primer
(F):5'- GGCACTATTATATCCAAAGACGATGG -3'
(R):5'- AGGCATTTTCACAGGAGTTGC -3'
Posted On2015-03-25